Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-196b URS0000611746_61853

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGGUAGUUUCCUGUUGUUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-196b
  2. Callorhinchus milii (elephant shark) Cmi-Mir-196-P3_5p (mature (guide))
  3. Cricetulus griseus cgr-miR-196b
  4. Equus caballus (horse) eca-miR-196b
  5. Gorilla gorilla gorilla ggo-miR-196b (MIR196B)
  6. Gorilla gorilla (western gorilla) ggo-miR-196b
  7. Homo sapiens hsa-miR-196b-5p
  8. Macaca mulatta (Rhesus monkey) mml-miR-196b-5p
  9. Microcebus murinus mmr-miR-196b
  10. Monodelphis domestica mdo-miR-196a-5p
  11. Mus musculus (house mouse) mmu-miR-196b-5p
  12. Ornithorhynchus anatinus Oan-Mir-196-P1_5p (mature (guide))
  13. Otolemur garnettii (small-eared galago) oga-miR-196b
  14. Pan troglodytes ptr-miR-196b
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-196b
  16. Pteropus alecto (black flying fox) pal-miR-196b-5p
  17. Rattus norvegicus rno-miR-196b-5p
  18. Sarcophilus harrisii Sha-Mir-196-P3_5p (mature (guide))
  19. Sus scrofa (pig) ssc-miR-196b-5p