Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR319a-3p URS000060FF66_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR319a-3p: Osa-mir319a-3p is a microRNA that has been found to be upregulated in the root tissue of N22 after SDS treatment [PMC5447883]. It has been shown to negatively target the TCP family transcription factor 4 (TCP4) [PMC8704135]. Unlike ata-miR164a-5p, osa-mir319a-3p.2-3p is upregulated under Cd and salt stresses [PMC8704135]. It has also been found to be highly expressed in the root and fruit, with its target genes AFB2 and TIR1 also highly expressed in the same tissues [PMC9879538]. Osa-mir319a-3p is one of several miRNAs predicted to target multiple genes, with only a few miRNAs predicted to hit a single target gene [PMC9597502]. In XZ29, osa-mir319a-3p was upregulated while ata-miR396a-5p and ata-miR396e-5p were downregulated, showing opposite expression patterns [PMC6069884]. Degradome analysis revealed that osa-mir319a-3p.2-3p was associated with several target genes, including TCP4 and growth-regulating factors [PMC6069884]. In Golden Promise, there was no significant difference in expression levels of osa-mir319a-3p.2-3p and its target gene compared to XZ29 [PMC6069884]. Osa-mir319a-3p is one of several miRNAs that regulate abiotic and biotic stress responses but its role in seed development has not yet been identified [PMC10116700]. References: [PMC5447883] [PMC8704135] [PMC9879538] [PMC9597502] [PMC6069884] [PMC10116700]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGGAUGACGCGGGAGCUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Aegilops tauschii ata-miR319-3p
  2. Oryza sativa Japonica Group microRNA osa-miR319a-3p
Publications