Automated summary: This tmRNA sequence is 209 nucleotides long and is found in Dinoroseobacter shibae DFL 12 = DSM 16493. Annotated by 2 databases (ENA, tmRNA Website). Matches 1 Rfam family (alpha_tmRNA, RF01849). Dinoroseobacter shibae DFL 12 = DSM 16493 transfer-messenger RNA Dinor_shiba_DFL12 sequence is a product of tmRNA Dinor_shiba_DFL12 gene.
This sequence is found in {{ locations.length }} genome
Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
---|---|---|---|---|---|---|---|---|
Loading genome locations... | ||||||||
Failed to load data from server | ||||||||
No genome locations known | ||||||||
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
GGGGCCGAAACAGGAUCGACGAACGUCUAAAGGGGUUAGCUUUGUCUCGGCUGGGUGCCACCGUUAUCGGCCUAAAUUGUACAGUUGCAAACGACAACCGUGCUCCGGUGGCCGUUGCUGCGUAAGCAGUAACAACACCGAAACUUAAGUCCUUGCGCCUAGCAGCGUAAGGCGGGGUUCGCAGGCACCUGGCAACAGAAGCCUGCACA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.