Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) Xtr-Let-7-P1c_3p* (star (passenger)) URS000060A34C_8364

  • 22 nucleotides
  • 1 database (MirGeneDB)
  • Found in 25 other species
  • miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGUACAACCUUCUAGCUUUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Alligator mississippiensis (American alligator) ami-let-7c-3p
  2. Anolis carolinensis aca-let-7c-1-3p
  3. Capra hircus (goat) chi-let-7c-3p
  4. Cavia porcellus (domestic guinea pig) cpo-let-7c-3p
  5. Cervus elaphus cel-let-7c-1-3p
  6. Chrysemys picta (Painted turtle) cpi-let-7c-3p
  7. Columba livia cli-let-7c-3p
  8. Cricetulus griseus cgr-let-7c
  9. Danio rerio (zebrafish) dre-let-7c-3p
  10. Dasypus novemcinctus dno-let-7c-3p
  11. Gallus gallus (chicken) gga-let-7c-3p
  12. Homo sapiens (human) hsa-let-7c-3p
  13. Macaca mulatta (Rhesus monkey) mml-let-7c-3p
  14. Mus musculus mmu-let-7c-1-3p
  15. Ophiophagus hannah (king cobra) oha-let-7c-3-3p
  16. Ornithorhynchus anatinus (platypus) oan-let-7c-3p
  17. Oryctolagus cuniculus (rabbit) ocu-let-7c-3p
  18. Paralichthys olivaceus (Japanese flounder) pol-let-7d-3p
  19. Pteropus alecto pal-let-7c-3p
  20. Python bivittatus pbv-let-7c-3p
  21. Rattus norvegicus rno-let-7c-1-3p
  22. Salmo salar ssa-let-7c-3p
  23. Taeniopygia guttata tgu-let-7c-3p
  24. Tor tambroides let-7c-3p
  25. Xenopus laevis (African clawed frog) xla-let-7c-3p