Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-let-7c-3p URS000060A34C_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (MirGeneDB, RefSeq, miRBase, GeneCards, IntAct, ENA, MalaCards). Described in 45 papers. Homo sapiens (human) hsa-let-7c-3p sequence is a product of MIRLET7C, let-7, hsa-let-7c-3p, miR-mizuguchi-224, hsa-let-7c, let-7c, let-7c-3p, has-miR-mizuguchi-224 genes. Found in the human reference genome.

Interactions 1

According to IntAct, Homo sapiens (human) hsa-let-7c-3p interacts with:

IntAct ID Participant Synonyms
EBI-25424462 intact:EBI-25424500 EBI-25424500 ENST00000307407 mrna_il8

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUGUACAACCUUCUAGCUUUCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 31 other species

    1. Alligator mississippiensis (American alligator) ami-let-7c-3p
    2. Anolis carolinensis aca-let-7c-1-3p
    3. Bos taurus Bta-Let-7-P1c_3p* (star (passenger))
    4. Canis lupus familiaris (dog) Cfa-Let-7-P1c_3p* (star (passenger))
    5. Capra hircus chi-let-7c-3p
    6. Cavia porcellus cpo-let-7c-3p
    7. Cervus elaphus (red deer) cel-let-7c-1-3p
    8. Chrysemys picta bellii Cpi-Let-7-P1c_3p* (star (passenger))
    9. Chrysemys picta cpi-let-7c-3p
    10. Columba livia cli-let-7c-3p
    11. Cricetulus griseus (Chinese hamster) cgr-let-7c
    12. Danio rerio (zebrafish) dre-let-7c-3p
    13. Dasypus novemcinctus (nine-banded armadillo) dno-let-7c-3p
    14. Echinops telfairi Ete-Let-7-P1c_3p* (star (passenger))
    15. Gallus gallus gga-let-7c-3p
    16. Lingula anatina Lan-Let-7_3p* (star (passenger))
    17. Lottia gigantea Lgi-Let-7_3p* (star (passenger))
    18. Macaca mulatta mml-let-7c-3p
    19. Mus musculus mmu-let-7c-1-3p
    20. Ophiophagus hannah oha-let-7c-3-3p
    21. Ornithorhynchus anatinus oan-let-7c-3p
    22. Oryctolagus cuniculus (rabbit) ocu-let-7c-3p
    23. Paralichthys olivaceus (Japanese flounder) pol-let-7d-3p
    24. Pteropus alecto (black flying fox) pal-let-7c-3p
    25. Python bivittatus (Burmese python) pbv-let-7c-3p
    26. Rattus norvegicus (Norway rat) rno-let-7c-1-3p
    27. Salmo salar (Atlantic salmon) ssa-let-7d-3p
    28. Sarcophilus harrisii (Tasmanian devil) Sha-Let-7-P1c_3p* (star (passenger))
    29. Taeniopygia guttata tgu-let-7c-3p
    30. Tor tambroides let-7c-3p
    31. Xenopus laevis (African clawed frog) xla-let-7c-3p
    32. Xenopus tropicalis (tropical clawed frog) Xtr-Let-7-P1c_3p* (star (passenger))