Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-379 URS000060A1F4_9796

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

eca-mir-379: Eca-mir-379 is a microRNA that is not influenced by sex but by species in horses [PMC9873782]. It is also influenced by species in terms of its prognostic potential [PMC9873782]. Eca-mir-379 and eca-miR-432 decrease in horses with successful therapy for ES disease and may serve as potential biomarkers for monitoring treatment interventions [PMC9873782]. Eca-mir-379 and eca-miR-432 are encoded on equine chromosome 24, which is associated with ES pathogenesis [PMC9873782]. In contrast to previous results, sex does not impact the expression of eca-mir-379 and eca-miR-432 [PMC9873782]. Eca-miR-127, eca-mir-379, and eca-miR-432 are chosen as candidate miRNAs based on their potential prognostic and diagnostic properties [PMC9873782]. Eca-mir-379 and eca-miR-432 show lower expression levels over time in horses with successful therapy for ES disease [PMC9873782]. Male equids have higher levels of eca-miR-127 compared to female equids, while horses have higher expression of eca-mir-379 and eca-miR-432 compared to donkeys [PMC9873782]. In terms of miRNA expression variation between groups, male horses show variation for ecami-R125a5p and -432 but not for -127 or -379. In the CTL group, there is variation between male and female horses for -127, -379, and -432. Sex has a significant influence on the expression of several miRNAs including -127, -134,- 3235p,- 382,- 125a5p,- 381,- 432, and -379 [PMC8699634]. These miRNAs are encoded on equine chromosome 24 and have putative tumor-suppressive function in ES disease [PMC8699634].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGUAGACUAUGGAACGUAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Bos taurus bta-miR-379
  2. Canis lupus familiaris cfa-miR-379
  3. Capra hircus (goat) chi-miR-379-5p
  4. Cavia porcellus (domestic guinea pig) cpo-miR-379-5p
  5. Cervus elaphus cel-miR-379
  6. Cricetulus griseus cgr-miR-379
  7. Dasypus novemcinctus dno-miR-379-5p
  8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P7_5p (mature (co-guide))
  9. Gorilla gorilla gorilla ggo-miR-379 (MIR379)
  10. Gorilla gorilla (western gorilla) ggo-miR-379
  11. Homo sapiens (human) hsa-miR-379-5p
  12. Macaca mulatta (Rhesus monkey) mml-miR-379-5p
  13. Mus musculus mmu-miR-379-5p
  14. Oryctolagus cuniculus (rabbit) ocu-miR-379-5p
  15. Ovis aries (sheep) microRNA miR-379
  16. Pan paniscus ppa-miR-379
  17. Pan troglodytes ptr-miR-379
  18. Pongo pygmaeus (Bornean orangutan) ppy-miR-379
  19. Pteropus alecto pal-miR-379-5p
  20. Rattus norvegicus rno-miR-379-5p
Publications