v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-4124855 URS0000605E00_8364

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AACAUUCAUUGCUGUCGGUGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Capra hircus chi-miR-181b-5p
  2. Cervus elaphus (red deer) cel-miR-181b
  3. Chiloscyllium plagiosum microRNA cpl-miR-181b
  4. Equus caballus eca-miR-181b
  5. Gallus gallus Gallus_gallus piRNA piR-gga-25044
  6. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-181c
  7. Homo sapiens hsa-miR-181b-5p
  8. Monodelphis domestica (gray short-tailed opossum) mdo-miR-181b-5p
  9. Mus musculus (house mouse) TARBASE:mmu-miR-181b-5p
  10. Ophiophagus hannah (king cobra) oha-miR-181b-5p
  11. Ornithorhynchus anatinus Oan-Mir-181-P2b_5p (mature (guide))
  12. Pan troglodytes ptr-miR-181b
  13. Pongo pygmaeus (Bornean orangutan) ppy-miR-181b
  14. Rattus norvegicus (Norway rat) rno-miR-181b-5p
  15. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-181-P2b_5p (mature (guide))
  16. Tupaia chinensis tch-miR-181b-5p