Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-181b-5p URS0000605E00_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (miRBase, MalaCards, GeneCards, PSICQUIC, LncBase, RefSeq, IntAct, ENA, TarBase). Described in 82 papers. Homo sapiens (human) hsa-miR-181b-5p sequence is a product of miR-181, hsa-miR-181b, MIR181B2, hsa-miR-181b-5p, miR-181b-5p, MIR181B1, miR-181b genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 12CC4, 14-3-3GAMMA, 14-3-3γ, 15E1.2, 2310047H23Rik, 2H9, 3G2, 4.1R, 9G8, A211C6.1.

Interactions 16

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-181b-5p interacts with:

Interaction id Participant Synonyms
EBI-26594801 intact:EBI-26567461 EBI-26567461 ENST00000307102 mrna_mek1
URS0000605E00_9606-9 P05231 P05231
URS0000605E00_9606-7 P05231 P05231
URS0000605E00_9606-0 P15502 P15502
URS0000605E00_9606-10 P25090 P25090
URS0000605E00_9606-1 P25090 P25090
URS0000605E00_9606-2 P35625 P35625
URS0000605E00_9606-11 P42262 P42262
URS0000605E00_9606-3 P42262 P42262
URS0000605E00_9606-12 P62760 P62760
URS0000605E00_9606-4 P62760 P62760
URS0000605E00_9606-5 Q8WXG6 Q8WXG6
URS0000605E00_9606-13 Q8WXG6 Q8WXG6
URS0000605E00_9606-6 Q9Y6W6 Q9Y6W6
URS0000605E00_9606-8 Q9Y6W6 Q9Y6W6
URS0000605E00_9606-14 Q9Y6W6 Q9Y6W6

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AACAUUCAUUGCUGUCGGUGGGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 36 other species

    1. Alligator mississippiensis Ami-Mir-181-P2c_5p (mature (guide))
    2. Capra hircus chi-miR-181b-5p
    3. Cervus elaphus (red deer) cel-miR-181b
    4. Chiloscyllium plagiosum microRNA cpl-miR-181b
    5. Chrysemys picta bellii Cpi-Mir-181-P2c_5p (mature (guide))
    6. Equus caballus eca-miR-181b
    7. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-25044
    8. Haplochromis burtoni abu-miR-181c
    9. Monodelphis domestica (gray short-tailed opossum) mdo-miR-181b-5p
    10. Mus musculus TARBASE:mmu-miR-181b-5p
    11. Ophiophagus hannah oha-miR-181b-5p
    12. Ornithorhynchus anatinus Oan-Mir-181-P2b_5p (mature (guide))
    13. Pan troglodytes (chimpanzee) ptr-miR-181b
    14. Pongo pygmaeus ppy-miR-181b
    15. Rattus norvegicus rno-miR-181b-5p
    16. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-181-P2b_5p (mature (guide))
    17. Tupaia chinensis (Chinese tree shrew) tch-miR-181b-5p
    18. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-4124855