v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) testis expressed transcript, Y-linked 4B (TTTY4B, TTTY4C) URS000060599D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

TTTY4B: TTTY4B is a non-coding gene that exhibits a common bimodal pattern of expression, with low expression in samples from fertile patients and high expression in samples from infertile patients [PMC6375207]. It is one of the top-10 down-regulated genes in chromosome Y associated with mLOY in tumors [PMC7682048]. The expression of TTTY4B is significantly correlated with sex, tumor status, and metastasis [PMC6580006]. TTTY4B is a candidate lncRNA for clear cell renal cell carcinoma (ccRCC) and is associated with overall survival time of ccRCC patients [PMC6580006]. It is also related to sex-dependent ccRCC and tumor metastasis [PMC6580006]. In the ceRNA network, TTTY4B is one of the upregulated lncRNAs that interacts with multiple distinct miRNAs [PMC8589383]. TTTY4B, a non-coding gene, exhibits distinct expression patterns in fertile and infertile patients [PMC6375207]. It also plays a role in mLOY-associated tumors and ccRCC progression [PMC7682048] [PMC6580006]. The correlation between TTTY4B expression and clinical variables suggests its potential as a diagnostic marker for sex-dependent ccRCC progression and overall survival time prediction for ccRCC patients. Additionally, TTTY4B interacts with multiple miRNAs as part of the ceRNA network. These findings highlight the importance of TTTY4B as a potential biomarker for infertility, mLOY-associated tumors, and ccRCC progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCCAGGUCUGCAGUUGGAGCCCAUUGUGUGAGGCAGUCUGUGAAGGAAGUGUGAGAACCACCCUCAUGAGGAAAGCUGUAGAGGAAGAGUGAGGAAUGCGACAGACUCCCUGAAAGCAAAGGUGGAAAAAGAAUUCACGUGGUGAAGUCAGUGACUAAUCAGUGAUGUAACUUUCCUCUCUGGAAUGGGCCCUGCUCAAAGAAAAGGUAGUGACAUGAUUCAAGACUGAGAACACAGGAACAUUAUGACAUAUCUUGAAGUAACAUCUGGAAGUGUGACGCUCGUCUCCUACCUGGGUCCUGACCGCAGAAUGAAUUGUGACAUACGACGGAGUACAAAACCUAGGUGAAAUUAUGCCAUAUACCUGAGACAGAUCAAAGGAAUAAUAACAACUUUAUACCUGGAGCCAGGAUGUGCAGAAUGGUGACUCUCAUUCCUGAACAUUUCCACCAGUGCUAUUGUGACAUACACCUUGGUCCAGCUCCUCAGUGAUUUAAUAAUCCUGCCUAAUUAUAGCCUGCAUAUGACAUUUUGACAUAUACCUGGACCUAGAACCUUGGUGAUUUGACUCUCCUGUUGUAGAGGGUCCUCAGAAAAAACUAUAACAUAUCUAUGGGCCCAUCAUCUAGGUAAUGUGAUGUUCCCCAUUUGUCUGAACCUCCUUUCAGUGAAGAGUGUGGCAUUUCUAAACACUGCAUCCAAAUGACAUGACUCUCUUGCCUGGGCCAUUUCAACAGGAGGCCUUGUGACAUAUCUCUGAGCCCAUCAUUUUGGUGAUAUGACUCUCCUCACCUGCCUGGACAUUGUCCACAAGAGGCAUUAUGCGAUAGAGCUGGGACUGGCACCAAAGUUUUCUGACUUUUCGGUUAGUGCCCUGCUGACAAAGAGAACGUUGUAAUACUUCUGGCUUAGAAUGUAGGUGAUGUGUUUGUUCUAUCUCUUUUAUAACCAAAGACGGGAUGGUGACAUAUAACUAGGCACAGCUAAUAGGCAUGAUAAUGACUCUCUUAUGUGGACCCAGCCAAUAGAAGAAAUGUUGCCUCUUAUAACUAGGUUUAGGGACAUGAGUGAUGUAGAAUCUCCUUCUGGUAAAAAGGUCACAGAAGAUUGCAACACUCACACAUAUUUUUUAACACCCUUGUGUUGAAUAGAGGGUGUCACAAAGCACCUAGCACACAGAAUAAAUUGUGAGUAUUGUAUGCACACCCAGCUGACAGCAAGGAAUUUCACCAUCACAGGUGGAUGAAGGCAUCUGUCCUACAUGAAAACAGGACAUGUGUGGUAUUCUAAAUCUAAUCCCCAGAAUUUUAUUUCUUCAAGACUGUGAUAUAAAUCUUUGCCAGUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications