Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-132 URS00006054DA_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-132: bta-mir-132 is a microRNA that has been studied in various contexts. In one study, it was found that there were differentially methylated regions (DMRs) within 10-kb upstream regions of the predicted transcription start site (TSS) for bta-mir-132, indicating a potential regulatory role for DNA methylation in its expression [PMC6691986]. Additionally, hypomethylation of a DMR located 9.4 kb upstream of the bta-mir-132 gene was observed, which may explain the upregulation of bta-mir-132 in muscle tissue [PMC6691986]. In another study, the miR-132 family (including bta-mir-132) was found to be highly expressed in granulosa cells of preovulatory dominant follicles compared to subordinate follicles [PMC4438052]. Furthermore, miR-132 cluster (including bta-mir-132) and miR-183 cluster were significantly enriched in preovulatory dominant follicles compared to subordinate follicles [PMC4438052]. Bta-mir-132 and bta-miR-212 are transcribed from an intergenic region on chromosome 19 and have the same seed region [PMC4438052]. Bta-mir-132 has also been found to be downregulated in adipose tissue compared to muscle tissue during metabolic stress recovery [PMC6731312]. Additionally, it has been moderately correlated with lactose levels in lactating cows [PMC6731312]. Bta-mir-132 has also been identified as differentially expressed during mammary gland infection with Staphylococcus aureus and is involved in pathogen infection regulation [PMC6600136]. Furthermore, it has been shown to have target genes involved in system development, signal transduction, sex differentiation, and growth and development of plants [PMC5429842].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAACAGUCUACAGCCAUGGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Alligator mississippiensis ami-miR-132-3p
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-132
  3. Canis lupus familiaris Cfa-Mir-132-P1_3p (mature (guide))
  4. Cavia porcellus (domestic guinea pig) cpo-miR-132-3p
  5. Cervus elaphus (red deer) cel-miR-132
  6. Chrysemys picta bellii (western painted turtle) Cpi-Mir-132-P1_3p (mature (co-guide))
  7. Chrysemys picta (Painted turtle) cpi-miR-132-3p
  8. Cricetulus griseus (Chinese hamster) cgr-miR-132-3p
  9. Cyprinus carpio (common carp) ccr-miR-132a
  10. Danio rerio (zebrafish) dre-miR-132-3p
  11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-132-3p
  12. Echinops telfairi Ete-Mir-132-P1_3p (mature (guide))
  13. Eptesicus fuscus efu-miR-132
  14. Equus caballus eca-miR-132
  15. Gadus morhua (Atlantic cod) Gmo-Mir-132-P1b_3p (mature (co-guide))
  16. Gallus gallus gga-miR-132a-3p
  17. Homo sapiens hsa-miR-132-3p
  18. Ictalurus punctatus ipu-miR-132b
  19. Latimeria chalumnae (coelacanth) Lch-Mir-132-P1_3p (mature (guide))
  20. Lepisosteus oculatus Loc-Mir-132-P1_3p (mature (co-guide))
  21. Macaca mulatta (Rhesus monkey) mml-miR-132-3p
  22. Microcebus murinus (gray mouse lemur) mmr-miR-132
  23. Monodelphis domestica (gray short-tailed opossum) mdo-miR-132-3p
  24. Monopterus albus Mal-Mir-132-P1a_3p (mature (guide))
  25. Mus musculus (house mouse) mmu-miR-132-3p
  26. Ornithorhynchus anatinus Oan-Mir-132-P1_3p (mature (guide))
  27. Otolemur garnettii oga-miR-132
  28. Pongo pygmaeus (Bornean orangutan) ppy-miR-132
  29. Pteropus alecto (black flying fox) pal-miR-132-3p
  30. Rattus norvegicus (Norway rat) rno-miR-132-3p
  31. Salmo salar ssa-miR-132-3p
  32. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-132-P1_3p (mature (guide))
  33. Scyliorhinus torazame (cloudy catshark) Sto-Mir-132-P1_3p (mature (guide))
  34. Sus scrofa ssc-miR-132
  35. Taeniopygia guttata (zebra finch) tgu-miR-132
  36. Takifugu rubripes fru-miR-132
  37. Tetraodon nigroviridis tni-miR-132
  38. Tor tambroides miR-132-3p
  39. Xenopus laevis (African clawed frog) Xla-Mir-132-P1c_3p (mature (guide))
  40. Xenopus tropicalis (tropical clawed frog) xtr-miR-132
Publications