Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-132 URS00006054DA_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-132: Ssc-mir-132 is a microRNA that has been found to be differentially expressed in various studies. In one study, it was upregulated in the HQ group compared to the LQ group, along with other miRNAs such as miR-193a-5p and miR-339-3p [PMC9208166]. In another study, ssc-mir-132 was upregulated in the RBP4 group [PMC8153112]. It has also been identified as one of the miRNAs that have regulative functions on fat deposition [PMC8834144]. Ssc-mir-132 has been found to interact with circ_7558 as a sponge [PMC9219244]. Additionally, ssc-mir-132 was one of the overlapping differentially expressed miRNAs in different pig breeds during labor onset [PMC4536519]. It was also detected in all of the regulated groups across comparisons of LL, QL, and QS with LN [PMC4536519]. Ssc-mir-132 was found to be unique to certain libraries in a study on porcine reproductive and respiratory syndrome virus (PRV) infection [PMC4391141]. Furthermore, it was differentially expressed after PRV infection along with other miRNAs such as ssc-miR-146b and ssc-miR-199a/b-3p [PMC4801506]. Ssc-mir-132 was also differentially expressed in both CK and TK groups in another study [PMC9275911].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAACAGUCUACAGCCAUGGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Alligator mississippiensis ami-miR-132-3p
  2. Bos taurus bta-miR-132
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-132
  4. Canis lupus familiaris Cfa-Mir-132-P1_3p (mature (guide))
  5. Cavia porcellus (domestic guinea pig) cpo-miR-132-3p
  6. Cervus elaphus (red deer) cel-miR-132
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-132-P1_3p (mature (co-guide))
  8. Chrysemys picta (Painted turtle) cpi-miR-132-3p
  9. Cricetulus griseus (Chinese hamster) cgr-miR-132-3p
  10. Cyprinus carpio (common carp) ccr-miR-132a
  11. Danio rerio (zebrafish) dre-miR-132-3p
  12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-132-3p
  13. Echinops telfairi Ete-Mir-132-P1_3p (mature (guide))
  14. Eptesicus fuscus efu-miR-132
  15. Equus caballus eca-miR-132
  16. Gadus morhua (Atlantic cod) Gmo-Mir-132-P1b_3p (mature (co-guide))
  17. Gallus gallus gga-miR-132a-3p
  18. Homo sapiens hsa-miR-132-3p
  19. Ictalurus punctatus ipu-miR-132b
  20. Latimeria chalumnae (coelacanth) Lch-Mir-132-P1_3p (mature (guide))
  21. Lepisosteus oculatus Loc-Mir-132-P1_3p (mature (co-guide))
  22. Macaca mulatta (Rhesus monkey) mml-miR-132-3p
  23. Microcebus murinus (gray mouse lemur) mmr-miR-132
  24. Monodelphis domestica (gray short-tailed opossum) mdo-miR-132-3p
  25. Monopterus albus Mal-Mir-132-P1a_3p (mature (guide))
  26. Mus musculus (house mouse) mmu-miR-132-3p
  27. Ornithorhynchus anatinus Oan-Mir-132-P1_3p (mature (guide))
  28. Otolemur garnettii oga-miR-132
  29. Pongo pygmaeus (Bornean orangutan) ppy-miR-132
  30. Pteropus alecto (black flying fox) pal-miR-132-3p
  31. Rattus norvegicus (Norway rat) rno-miR-132-3p
  32. Salmo salar ssa-miR-132-3p
  33. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-132-P1_3p (mature (guide))
  34. Scyliorhinus torazame (cloudy catshark) Sto-Mir-132-P1_3p (mature (guide))
  35. Taeniopygia guttata (zebra finch) tgu-miR-132
  36. Takifugu rubripes fru-miR-132
  37. Tetraodon nigroviridis tni-miR-132
  38. Tor tambroides miR-132-3p
  39. Xenopus laevis (African clawed frog) Xla-Mir-132-P1c_3p (mature (guide))
  40. Xenopus tropicalis (tropical clawed frog) xtr-miR-132
Publications