v21

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-132 URS00006054DA_9823

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Sus scrofa. Annotated by 3 databases (miRBase, ENA, RefSeq). Sus scrofa (pig) ssc-miR-132 sequence is a product of MIR132, miR-132, ssc-miR-132 genes. Found in the pig reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UAACAGUCUACAGCCAUGGUCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 40 other species

    1. Alligator mississippiensis ami-miR-132-3p
    2. Bos taurus bta-miR-132
    3. Callithrix jacchus cja-miR-132
    4. Canis lupus familiaris (dog) Cfa-Mir-132-P1_3p (mature (guide))
    5. Cavia porcellus cpo-miR-132-3p
    6. Cervus elaphus (red deer) cel-miR-132
    7. Chrysemys picta bellii Cpi-Mir-132-P1_3p (mature (co-guide))
    8. Chrysemys picta cpi-miR-132-3p
    9. Cricetulus griseus (Chinese hamster) cgr-miR-132-3p
    10. Cyprinus carpio ccr-miR-132a
    11. Danio rerio (zebrafish) dre-miR-132-3p
    12. Dasypus novemcinctus dno-miR-132-3p
    13. Echinops telfairi Ete-Mir-132-P1_3p (mature (guide))
    14. Eptesicus fuscus (big brown bat) efu-miR-132
    15. Equus caballus (horse) eca-miR-132
    16. Gadus morhua Gmo-Mir-132-P1b_3p (mature (co-guide))
    17. Gallus gallus (chicken) gga-miR-132a-3p
    18. Homo sapiens hsa-miR-132-3p
    19. Ictalurus punctatus ipu-miR-132b
    20. Latimeria chalumnae Lch-Mir-132-P1_3p (mature (guide))
    21. Lepisosteus oculatus Loc-Mir-132-P1_3p (mature (co-guide))
    22. Macaca mulatta mml-miR-132-3p
    23. Microcebus murinus mmr-miR-132
    24. Monodelphis domestica (gray short-tailed opossum) mdo-miR-132-3p
    25. Monopterus albus (swamp eel) Mal-Mir-132-P1a_3p (mature (guide))
    26. Mus musculus mmu-miR-132-3p
    27. Ornithorhynchus anatinus (platypus) Oan-Mir-132-P1_3p (mature (guide))
    28. Otolemur garnettii oga-miR-132
    29. Pongo pygmaeus (Bornean orangutan) ppy-miR-132
    30. Pteropus alecto (black flying fox) pal-miR-132-3p
    31. Rattus norvegicus (Norway rat) rno-miR-132-3p
    32. Salmo salar (Atlantic salmon) ssa-miR-132-3p
    33. Sarcophilus harrisii Sha-Mir-132-P1_3p (mature (guide))
    34. Scyliorhinus torazame Sto-Mir-132-P1_3p (mature (guide))
    35. Taeniopygia guttata (zebra finch) tgu-miR-132
    36. Takifugu rubripes fru-miR-132
    37. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-132
    38. Tor tambroides (Thai mahseer) miR-132-3p
    39. Xenopus laevis Xla-Mir-132-P1c_3p (mature (guide))
    40. Xenopus tropicalis (tropical clawed frog) xtr-miR-132
     Publications New