Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-132-3p URS00006054DA_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (GeneCards, ENA, MirGeneDB, miRBase, PSICQUIC, RefSeq, MalaCards, IntAct, TarBase, LncBase). Homo sapiens (human) hsa-miR-132-3p sequence is a product of hsa-miR-132, hsa-miR-132-3p, miR-132, miR-132-3p, MIR132 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 133K02, 13CDNA73, 14-3-3, 182-FIP, 39K2, 5'OY11.1, 80K-L, 82-FIP, A20, A43.

Interactions 13

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-132-3p interacts with:

Interaction id Participant Synonyms
EBI-22051755 intact:EBI-21019594 EBI-21019594 ENST00000405375 mrna_cdkn1a
URS00006054DA_9606-0 P17948 P17948
URS00006054DA_9606-1 P19320 P19320
URS00006054DA_9606-8 P20936 P20936
URS00006054DA_9606-2 P20936 P20936
URS00006054DA_9606-3 P20936 P20936
URS00006054DA_9606-4 P29475 P29475
URS00006054DA_9606-9 P29475 P29475
URS00006054DA_9606-10 P38936 P38936
URS00006054DA_9606-7 P38936 P38936
URS00006054DA_9606-5 Q13480 Q13480
URS00006054DA_9606-11 Q13480 Q13480
URS00006054DA_9606-6 Q9NQ30 Q9NQ30

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAACAGUCUACAGCCAUGGUCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 40 other species

    1. Alligator mississippiensis (American alligator) ami-miR-132-3p
    2. Bos taurus bta-miR-132
    3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-132
    4. Canis lupus familiaris (dog) Cfa-Mir-132-P1_3p (mature (guide))
    5. Cavia porcellus cpo-miR-132-3p
    6. Cervus elaphus (red deer) cel-miR-132
    7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-132-P1_3p (mature (co-guide))
    8. Chrysemys picta cpi-miR-132-3p
    9. Cricetulus griseus (Chinese hamster) cgr-miR-132-3p
    10. Cyprinus carpio ccr-miR-132a
    11. Danio rerio dre-miR-132-3p
    12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-132-3p
    13. Echinops telfairi Ete-Mir-132-P1_3p (mature (guide))
    14. Eptesicus fuscus (big brown bat) efu-miR-132
    15. Equus caballus eca-miR-132
    16. Gadus morhua (Atlantic cod) Gmo-Mir-132-P1b_3p (mature (co-guide))
    17. Gallus gallus (chicken) gga-miR-132a-3p
    18. Ictalurus punctatus ipu-miR-132b
    19. Latimeria chalumnae Lch-Mir-132-P1_3p (mature (guide))
    20. Lepisosteus oculatus Loc-Mir-132-P1_3p (mature (co-guide))
    21. Macaca mulatta mml-miR-132-3p
    22. Microcebus murinus mmr-miR-132
    23. Monodelphis domestica (gray short-tailed opossum) mdo-miR-132-3p
    24. Monopterus albus Mal-Mir-132-P1a_3p (mature (guide))
    25. Mus musculus mmu-miR-132-3p
    26. Ornithorhynchus anatinus (platypus) Oan-Mir-132-P1_3p (mature (guide))
    27. Otolemur garnettii oga-miR-132
    28. Pongo pygmaeus ppy-miR-132
    29. Pteropus alecto (black flying fox) pal-miR-132-3p
    30. Rattus norvegicus rno-miR-132-3p
    31. Salmo salar ssa-miR-132-3p
    32. Sarcophilus harrisii Sha-Mir-132-P1_3p (mature (guide))
    33. Scyliorhinus torazame Sto-Mir-132-P1_3p (mature (guide))
    34. Sus scrofa (pig) ssc-miR-132
    35. Taeniopygia guttata tgu-miR-132
    36. Takifugu rubripes (torafugu) fru-miR-132
    37. Tetraodon nigroviridis tni-miR-132
    38. Tor tambroides miR-132-3p
    39. Xenopus laevis Xla-Mir-132-P1c_3p (mature (guide))
    40. Xenopus tropicalis (tropical clawed frog) xtr-miR-132
    Publications New