Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Alligator mississippiensis (American alligator) ami-miR-132-3p URS00006054DA_8496

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Alligator mississippiensis. Annotated by 1 database (miRBase).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAACAGUCUACAGCCAUGGUCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 40 other species

    1. Bos taurus (cattle) bta-miR-132
    2. Callithrix jacchus cja-miR-132
    3. Canis lupus familiaris Cfa-Mir-132-P1_3p (mature (guide))
    4. Cavia porcellus (domestic guinea pig) cpo-miR-132-3p
    5. Cervus elaphus (red deer) cel-miR-132
    6. Chrysemys picta bellii Cpi-Mir-132-P1_3p (mature (co-guide))
    7. Chrysemys picta (Painted turtle) cpi-miR-132-3p
    8. Cricetulus griseus cgr-miR-132-3p
    9. Cyprinus carpio ccr-miR-132a
    10. Danio rerio (zebrafish) dre-miR-132-3p
    11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-132-3p
    12. Echinops telfairi Ete-Mir-132-P1_3p (mature (guide))
    13. Eptesicus fuscus efu-miR-132
    14. Equus caballus (horse) eca-miR-132
    15. Gadus morhua (Atlantic cod) Gmo-Mir-132-P1b_3p (mature (co-guide))
    16. Gallus gallus (chicken) gga-miR-132a-3p
    17. Homo sapiens (human) hsa-miR-132-3p
    18. Ictalurus punctatus (channel catfish) ipu-miR-132b
    19. Latimeria chalumnae Lch-Mir-132-P1_3p (mature (guide))
    20. Lepisosteus oculatus Loc-Mir-132-P1_3p (mature (co-guide))
    21. Macaca mulatta mml-miR-132-3p
    22. Microcebus murinus (gray mouse lemur) mmr-miR-132
    23. Monodelphis domestica (gray short-tailed opossum) mdo-miR-132-3p
    24. Monopterus albus Mal-Mir-132-P1a_3p (mature (guide))
    25. Mus musculus mmu-miR-132-3p
    26. Ornithorhynchus anatinus (platypus) Oan-Mir-132-P1_3p (mature (guide))
    27. Otolemur garnettii oga-miR-132
    28. Pongo pygmaeus (Bornean orangutan) ppy-miR-132
    29. Pteropus alecto pal-miR-132-3p
    30. Rattus norvegicus (Norway rat) rno-miR-132-3p
    31. Salmo salar (Atlantic salmon) ssa-miR-132-3p
    32. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-132-P1_3p (mature (guide))
    33. Scyliorhinus torazame (cloudy catshark) Sto-Mir-132-P1_3p (mature (guide))
    34. Sus scrofa ssc-miR-132
    35. Taeniopygia guttata (zebra finch) tgu-miR-132
    36. Takifugu rubripes fru-miR-132
    37. Tetraodon nigroviridis tni-miR-132
    38. Tor tambroides miR-132-3p
    39. Xenopus laevis (African clawed frog) Xla-Mir-132-P1c_3p (mature (guide))
    40. Xenopus tropicalis xtr-miR-132