v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-132-3p URS00006054DA_10116

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Rattus norvegicus. Annotated by 4 databases (RefSeq, MirGeneDB, miRBase, PirBase). Rattus norvegicus (Norway rat) rno-miR-132-3p sequence is a product of miR-132, rno-miR-132-3p, rno-miR-132, Mir132, miR-132-3p genes. Found in the Rattus norvegicus reference genome.

Interactions 2

According to PSICQUIC, Rattus norvegicus (Norway rat) rno-miR-132-3p interacts with:

Interaction id Participant Synonyms
URS00006054DA_10116-0 D3ZYK8 D3ZYK8
URS00006054DA_10116-1 D3ZYK8 D3ZYK8

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UAACAGUCUACAGCCAUGGUCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 40 other species

    1. Alligator mississippiensis (American alligator) ami-miR-132-3p
    2. Bos taurus (cattle) bta-miR-132
    3. Callithrix jacchus cja-miR-132
    4. Canis lupus familiaris Cfa-Mir-132-P1_3p (mature (guide))
    5. Cavia porcellus (domestic guinea pig) cpo-miR-132-3p
    6. Cervus elaphus (red deer) cel-miR-132
    7. Chrysemys picta bellii Cpi-Mir-132-P1_3p (mature (co-guide))
    8. Chrysemys picta (Painted turtle) cpi-miR-132-3p
    9. Cricetulus griseus cgr-miR-132-3p
    10. Cyprinus carpio ccr-miR-132a
    11. Danio rerio (zebrafish) dre-miR-132-3p
    12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-132-3p
    13. Echinops telfairi Ete-Mir-132-P1_3p (mature (guide))
    14. Eptesicus fuscus efu-miR-132
    15. Equus caballus (horse) eca-miR-132
    16. Gadus morhua (Atlantic cod) Gmo-Mir-132-P1b_3p (mature (co-guide))
    17. Gallus gallus (chicken) gga-miR-132a-3p
    18. Homo sapiens (human) hsa-miR-132-3p
    19. Ictalurus punctatus (channel catfish) ipu-miR-132b
    20. Latimeria chalumnae Lch-Mir-132-P1_3p (mature (guide))
    21. Lepisosteus oculatus Loc-Mir-132-P1_3p (mature (co-guide))
    22. Macaca mulatta mml-miR-132-3p
    23. Microcebus murinus (gray mouse lemur) mmr-miR-132
    24. Monodelphis domestica (gray short-tailed opossum) mdo-miR-132-3p
    25. Monopterus albus Mal-Mir-132-P1a_3p (mature (guide))
    26. Mus musculus mmu-miR-132-3p
    27. Ornithorhynchus anatinus (platypus) Oan-Mir-132-P1_3p (mature (guide))
    28. Otolemur garnettii oga-miR-132
    29. Pongo pygmaeus (Bornean orangutan) ppy-miR-132
    30. Pteropus alecto pal-miR-132-3p
    31. Salmo salar (Atlantic salmon) ssa-miR-132-3p
    32. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-132-P1_3p (mature (guide))
    33. Scyliorhinus torazame (cloudy catshark) Sto-Mir-132-P1_3p (mature (guide))
    34. Sus scrofa ssc-miR-132
    35. Taeniopygia guttata (zebra finch) tgu-miR-132
    36. Takifugu rubripes fru-miR-132
    37. Tetraodon nigroviridis tni-miR-132
    38. Tor tambroides miR-132-3p
    39. Xenopus laevis (African clawed frog) Xla-Mir-132-P1c_3p (mature (guide))
    40. Xenopus tropicalis xtr-miR-132
     Publications