Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-132-3p URS00006054DA_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (ENA, MirGeneDB, miRBase, RefSeq, TarBase, PirBase, LncBase). Mus musculus (house mouse) mmu-miR-132-3p sequence is a product of 132, miR-132, Mir132, mmu-miR-132, miR-132-3p, mmu-miR-132-3p genes. Found in the house mouse reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610009E20Rik, 0610009F02Rik, 0610025L18Rik, 0610030G24Rik, 0710005M05Rik, 107kDa, 1100001F19Rik, 1110001A17Rik, 1110001I14Rik, 1110001M19Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAACAGUCUACAGCCAUGGUCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 40 other species

    1. Alligator mississippiensis (American alligator) ami-miR-132-3p
    2. Bos taurus bta-miR-132
    3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-132
    4. Canis lupus familiaris (dog) Cfa-Mir-132-P1_3p (mature (guide))
    5. Cavia porcellus cpo-miR-132-3p
    6. Cervus elaphus (red deer) cel-miR-132
    7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-132-P1_3p (mature (co-guide))
    8. Chrysemys picta cpi-miR-132-3p
    9. Cricetulus griseus (Chinese hamster) cgr-miR-132-3p
    10. Cyprinus carpio ccr-miR-132a
    11. Danio rerio dre-miR-132-3p
    12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-132-3p
    13. Echinops telfairi Ete-Mir-132-P1_3p (mature (guide))
    14. Eptesicus fuscus (big brown bat) efu-miR-132
    15. Equus caballus eca-miR-132
    16. Gadus morhua (Atlantic cod) Gmo-Mir-132-P1b_3p (mature (co-guide))
    17. Gallus gallus (chicken) gga-miR-132a-3p
    18. Homo sapiens hsa-miR-132-3p
    19. Ictalurus punctatus ipu-miR-132b
    20. Latimeria chalumnae Lch-Mir-132-P1_3p (mature (guide))
    21. Lepisosteus oculatus Loc-Mir-132-P1_3p (mature (co-guide))
    22. Macaca mulatta mml-miR-132-3p
    23. Microcebus murinus mmr-miR-132
    24. Monodelphis domestica (gray short-tailed opossum) mdo-miR-132-3p
    25. Monopterus albus Mal-Mir-132-P1a_3p (mature (guide))
    26. Ornithorhynchus anatinus (platypus) Oan-Mir-132-P1_3p (mature (guide))
    27. Otolemur garnettii oga-miR-132
    28. Pongo pygmaeus ppy-miR-132
    29. Pteropus alecto (black flying fox) pal-miR-132-3p
    30. Rattus norvegicus rno-miR-132-3p
    31. Salmo salar ssa-miR-132-3p
    32. Sarcophilus harrisii Sha-Mir-132-P1_3p (mature (guide))
    33. Scyliorhinus torazame Sto-Mir-132-P1_3p (mature (guide))
    34. Sus scrofa (pig) ssc-miR-132
    35. Taeniopygia guttata tgu-miR-132
    36. Takifugu rubripes (torafugu) fru-miR-132
    37. Tetraodon nigroviridis tni-miR-132
    38. Tor tambroides miR-132-3p
    39. Xenopus laevis Xla-Mir-132-P1c_3p (mature (guide))
    40. Xenopus tropicalis (tropical clawed frog) xtr-miR-132
    Publications New