Tribolium castaneum (red flour beetle) tca-miR-137-3p URS0000601DD7_7070

• 22 nucleotides
• 3 databases (ENA, miRBase, RefSeq)
• Found in 6 other species
• 256 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UUAUUGCUUGAGAAUACACGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

1. Apis mellifera (honey bee) ame-miR-137-3p
2. Bombyx mori (domestic silkworm) bmo-miR-137
3. Heliconius melpomene (postman butterfly) hme-miR-137
4. Nasonia giraulti ngi-miR-137
5. Nasonia longicornis nlo-miR-137
6. Nasonia vitripennis nvi-miR-137

Publications Download

• FASTA
• JSON