Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-101a URS00005FF45E_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 4 databases (RefSeq, ENA, miRBase, MirGeneDB). Described in 14 papers. Danio rerio (zebrafish) dre-miR-101a sequence is a product of miR-101a, dre-miR-101a, mir101a, miR-101 genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UACAGUACUGUGAUAACUGAAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 87 other species

    1. Alligator mississippiensis ami-miR-101-3p
    2. Anolis carolinensis Aca-Mir-101-P2-v2_3p (mature (guide))
    3. Ateles geoffroyi (black-handed spider monkey) age-miR-101
    4. Bos taurus (cattle) Bta-Mir-101-P2-v2_3p (mature (guide))
    5. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-101
    6. Canis lupus familiaris (dog) Cfa-Mir-101-P2-v2_3p (mature (guide))
    7. Cavia porcellus cpo-miR-101-3p
    8. Cervus elaphus (red deer) cel-miR-101
    9. Chrysemys picta bellii Cpi-Mir-101-P2-v2_3p (mature (guide))
    10. Chrysemys picta cpi-miR-101-3p
    11. Columba livia Cli-Mir-101-P2-v2_3p (mature (guide))
    12. Cricetulus griseus (Chinese hamster) cgr-miR-101b-3p
    13. Cyprinus carpio (common carp) ccr-miR-101a
    14. Dasypus novemcinctus (nine-banded armadillo) dno-miR-101-3p
    15. Echinops telfairi Ete-Mir-101-P2-v2_3p (mature (guide))
    16. Gallus gallus (chicken) Gga-Mir-101-P2-v2_3p (mature (guide))
    17. Gorilla gorilla (western gorilla) ggo-miR-101
    18. Haplochromis burtoni abu-miR-101a
    19. Homo sapiens (human) Hsa-Mir-101-P2-v2_3p (mature (guide))
    20. Ictalurus punctatus ipu-miR-101a
    21. Lagothrix lagotricha (brown woolly monkey) lla-miR-101
    22. Macaca mulatta mml-miR-101-3p
    23. Macaca nemestrina mne-miR-101
    24. Maylandia zebra (zebra mbuna) mze-miR-101a
    25. Monodelphis domestica (gray short-tailed opossum) mdo-miR-101-3p
    26. Mus musculus Mmu-Mir-101-P1-v2_3p (mature (guide))
    27. Neolamprologus brichardi nbr-miR-101a
    28. Ophiophagus hannah oha-miR-101b-3p
    29. Oreochromis niloticus (Nile tilapia) oni-miR-101a
    30. Ornithorhynchus anatinus oan-miR-101
    31. Oryctolagus cuniculus ocu-miR-101-3p
    32. Pan paniscus ppa-miR-101
    33. Pan troglodytes (chimpanzee) ptr-miR-101
    34. Pongo pygmaeus microRNA mir-101-1
    35. Pundamilia nyererei pny-miR-101a
    36. Python bivittatus pbv-miR-101-3p
    37. Rattus norvegicus Rno-Mir-101-P1-v2_3p (mature (guide))
    38. Saguinus labiatus sla-miR-101
    39. Salmo salar ssa-miR-101a-3p
    40. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-101-P2-v2_3p (mature (guide))
    41. Scyliorhinus torazame (cloudy catshark) Sto-Mir-101-P2-v2_3p (mature (guide))
    42. Taeniopygia guttata (zebra finch) Tgu-Mir-101-P2-v2_3p (mature (guide))
    43. Takifugu rubripes fru-miR-101a
    44. Tetraodon nigroviridis tni-miR-101a
    45. Tor tambroides miR-101a
    46. Xenopus laevis xla-miR-101-3p
    47. Xenopus tropicalis xtr-miR-101a