Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1266-5p URS00005FDCD1_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (MirGeneDB, miRBase, MalaCards, GeneCards, RefSeq, IntAct, ENA, TarBase). Described in 19 papers. Homo sapiens (human) hsa-miR-1266-5p sequence is a product of hsa-miR-1266, miR-1266, miR-1266-5p, MIR1266, hsa-miR-1266-5p genes. Found in the human reference genome. Interacts with protein-coding genes, including ATX, CGI-115, CYB5R3, DIA1, DJ122O8.2, DUSP2, EDEM, EDEM1, ENSG00000067533, ENSG00000083099.

Interactions 8

According to IntAct, Homo sapiens (human) hsa-miR-1266-5p interacts with:

Interaction id Participant Synonyms
EBI-25829372 intact:EBI-25828762 EBI-25828762 ENST00000351677 mrna_ptpn11
EBI-26352951 intact:EBI-25828762 EBI-25828762 ENST00000351677 mrna_ptpn11
EBI-26352921 intact:EBI-26302294 EBI-26302294 ENST00000374864 mrna_itch
EBI-25829377 intact:EBI-26302294 EBI-26302294 ENST00000374864 mrna_itch
EBI-25829387 intact:EBI-26352892 EBI-26352892 ENST00000330871 mrna socs3
EBI-26352941 intact:EBI-26352892 EBI-26352892 ENST00000330871 mrna socs3
EBI-25829382 intact:EBI-26352903 EBI-26352903 ENST00000315050 mrna_tnip1
EBI-26352931 intact:EBI-26352903 EBI-26352903 ENST00000315050 mrna_tnip1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CCUCAGGGCUGUAGAACAGGGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 1 other species

    1. Pan troglodytes (chimpanzee) ptr-miR-1266