Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1266-5p URS00005FDCD1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1266: Hsa-mir-1266 is a microRNA that has been found to be related to prognosis in various studies [PMC6151886]. It is part of a five-miRNA signature that includes hsa-miR-203, hsa-miR-424, hsa-mir-1293, and hsa-miR-4772 [PMC5955976]. The expression levels of hsa-mir-1266 have been found to be associated with the MTHFR gene and its 3'UTR region [PMC4505847]. Specifically, the MTHFR 2244 A → G substitution has been shown to increase the binding activity of hsa-mir-1266 with the MTHFR 3'UTR [PMC4505847]. Hsa-mir-1266 has also been implicated in gastric cancer, with decreased expression observed in gastric cancer tissues [PMC5073992]. In addition, it is part of miRNA cliques and has been found to regulate target mRNAs related to neuronal development and neurodegenerative diseases [PMC3878884]. Overall, these studies suggest that hsa-mir-1266 plays a role in prognosis and gene regulation in various diseases and conditions.

mRNA interactions 4 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUCAGGGCUGUAGAACAGGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-1266
Publications