Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-151a-5p URS00005F8E5B_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (MalaCards, ENA, TarBase, RefSeq, LncBase, GeneCards, miRBase). Described in 51 papers. Homo sapiens (human) hsa-miR-151a-5p sequence is a product of MIR151A, hsa-miR-151a, hsa-miR-151a-5p, miR-151, miR-151a-5p, miR-151a genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-8D, 1-8U, 182-FIP, 80K-L, 82-FIP, A4, A4-LSB, AA, AAAT, AAC1.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCGAGGAGCUCACAGUCUAGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 16 other species

    1. Bos taurus bta-miR-151-5p
    2. Canis lupus familiaris (dog) cfa-miR-151
    3. Capra hircus chi-miR-151-5p
    4. Cervus elaphus (red deer) cel-miR-151*
    5. Cricetulus griseus (Chinese hamster) cgr-miR-151-5p
    6. Daubentonia madagascariensis (aye-aye) dma-miR-151
    7. Equus caballus eca-miR-151-5p
    8. Macaca mulatta mml-miR-151-5p
    9. Mus musculus mmu-miR-151-5p
    10. Oryctolagus cuniculus (rabbit) ocu-miR-151-5p
    11. Otolemur garnettii oga-miR-28b
    12. Papio hamadryas (hamadryas baboon) pha-miR-151
    13. Pongo pygmaeus (Bornean orangutan) ppy-miR-151a-5p
    14. Pteropus alecto (black flying fox) pal-miR-151-5p
    15. Rattus norvegicus (Norway rat) rno-miR-151-5p
    16. Sus scrofa (pig) ssc-miR-151-5p
    17. Tursiops truncatus (common bottlenose dolphin) miR-151