Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MACC1 antisense RNA 1 (MACC1-AS1) URS00005F5556_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MACC1-AS1: MACC1-AS1 is a long non-coding RNA (lncRNA) that is upregulated in gastric cancer (GC) and regulates cancer cell metabolic plasticity and stemness through interactions with AMPK/Lin28 signaling [PMC7165246]. MACC1-AS1 enhances glycolysis, contributing to the progression of GC [PMC7162922]. In a recent study, it was found that MACC1-AS1 expression in GC cells is induced by TGF-β1 secreted by mesenchymal stem cells (MSCs) through the activation of SMAD2 and SMAD3 signaling [PMC8579446]. MACC1-AS1 overexpression has been shown to promote cell proliferation, epithelial-mesenchymal transition (EMT), and invasion in hepatocellular carcinoma (HCC) through the regulation of PAX8 [PMC6977655]. Additionally, MACC1-AS1 has been found to potentiate pyruvate kinase M2-driven phosphorylation of NOTCH1 in HCC cells [PMC8220219]. In gastric cancer, inhibition of the TGF-β signaling pathway has been suggested as a potential strategy to suppress MSC-induced stemness and chemoresistance by suppressing MACC1-AS1 expression [PMC7660620]. Knockdown of MACC1-AS1 has been shown to inhibit cell proliferation and increase cisplatin sensitivity in esophageal cancer cells [PMC7819824]. Furthermore, MACC1-AS1 has been found to physically interact with MACC1 mRNA, suggesting a potential regulatory role for this lncRNA in gene expression [PMC5838949]. The expression of MACC1-AS1 is also associated with prognosis in pancreatic cancer [PMC6686482], as well as GC and breast cancer cell lines compared to non-cancerous cells [PMC5838949]. In hepatocellular carcinoma, the silencing or aberrant expression of MACC1-AS1 affects cell cycle progression and apoptosis rates [PMC6686482].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAAUUGUAGAAUACACACACACACGCACACACACACACACGUCACACACACAGCACCUUAAAAUGAAUUUUCUCUAGGGAAACAACAAAAUGAACCCUGCACUUGAACAACACUUCAUUUUCAGUACCAUUAGCUGAAGAAGUAUUAAGGCAAGGUUGCCUUCUUAAUGAUUAUUUCAUGUGUUCUAUCCUCAGUACAUCAUUUACAAUAUUCAGACUUGGAACAAAGUACUUUGAACUCUCCAGCGGCCAGUCAGAAAAUGAGGAACAGGUUGUGAAUAGAAGAUACAAAGGAGUAUUAGAUCUGCAUUGAUUAAAUGGUGACUACAAAUAGACUUAAAAUACAUCUUCCCAAUUAUGAAUCUCUACAGGUGGUUUUGUCCUGUUCACCCAACUGGAAUGGUUGCAUCGAAGCAAGAAAAUUUUCUCCAAAAAUUAAUACCCAGAUCUACGCCAAAAACAAAGUGAAGAAUACAGCUUCUGCUCUCACCAAGUCAUCUCUAAUAGAGAGAAGAUUUCCUUAAACAUAAAUAUCUUCAAAAUGCUUGUUCAUUUGAGAGAAAGAUACAGAAUAUUUUACAUGUGCCCUUCACUGGAAUAUUUUUAUUUAUUUAAUUCAAUAAAAAUUGACUCCCAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications