Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) microRNA dme-mir-7 precursor URS00005F4704_7227

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dme-mir-7: Dme-mir-7 is a specific miRNA assay control for Drosophila melanogaster (D. melanogaster) [PMC6224079]. It was used in a pilot run to confirm the absence of plant/insect miRNA contamination and unspecific amplifications in serum samples [PMC6224079]. Dme-mir-7 was also included in a Taqman Low-Density Array (TLDA) card for qPCR analysis of mature human miRNAs [PMC6224079]. In a study comparing different miRNAs, dme-mir-7 was found to have 5325 recovered regions, with the SBM method returning 28 [PMC2365947]. The dme-mir-7 results showed an average of 273 sequences scoring equal to or better than the left-out sequences and an average of 8868 sequences scoring at least as high as the validated target using miRanda [PMC2365947]. In another study, dme-mir-7 was used as a spike-in RNA for RNA isolation and reverse transcription in serum samples [PMC8615628]. It was also found to be significantly down-regulated in SSc-A-MSCs compared to HC-A-MSCs, with a fold change less than 0.5 [PMC6509164]. The cDNA synthesized from total RNA using dme-mir-7 RT-primer was used for TaqMan MicroRNA Assay analysis [PMC4273950].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGUGCAUUCCGUAUGGAAGACUAGUGAUUUUGUUGUUUGGUCUUUGGUAAUAACAAUAAAUCCCUUGUCUUCUUACGGCGUGCAUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Drosophila sechellia microRNA dse-mir-7 precursor
  2. Drosophila simulans microRNA dsi-mir-7 precursor
Publications