Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4448 URS00005F305A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4448: Hsa-mir-4448 is a microRNA that has been found to be differentially expressed in various conditions, including RSV infection and thyroid eye disease (TED) [PMC6029031] [PMC6478035] [PMC9816116]. In RSV-infected moDCs, hsa-mir-4448, along with hsa-miR-30a-5p and hsa-miR-4634, showed significant changes in expression [PMC6029031]. Functional analysis revealed that CCDC88A is one of the target genes for hsa-mir-4448 [PMC6029031]. In the context of TED, hsa-mir-4448 was one of the miRNAs that showed significant differential expression when compared to healthy controls [PMC9816116]. Additionally, hsa-mir-4448 has been found to be altered in cancer and may have regulatory properties as an oncogene [PMC4951330]. Furthermore, hsa-mir-4448 has been implicated in regulating critical pathways related to MICA expression [PMC6036181]. It has also been identified as a binding partner for regulating the expression of IGF1 [PMC7775584]. Overall, hsa-mir-4448 is a microRNA that exhibits differential expression in various conditions and may have important regulatory roles in different biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCUCCUUGGUCUAGGGGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications