Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ophiophagus hannah (king cobra) oha-miR-365a-2-5p URS00005EEDFF_8665

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGGACUUUCAGGGGCAGCUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Anolis carolinensis (green anole) aca-miR-365-5p
  2. Cavia porcellus cpo-miR-365-2-5p
  3. Cervus elaphus Cel-miR-365-5p
  4. Chrysemys picta cpi-miR-365-5p
  5. Cricetulus griseus (Chinese hamster) cgr-miR-365
  6. Dasypus novemcinctus dno-miR-365-2-5p
  7. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-1419
  8. Mus musculus (house mouse) mmu-miR-365-2-5p
  9. Oryctolagus cuniculus (rabbit) ocu-miR-365-2-5p
  10. Pteropus alecto (black flying fox) pal-miR-365b-5p
Publications