Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA let-7a-1 (ENSGGOG00000030966.2) URS00005EB5B7_9595

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000002894.1)
  2. Ateles geoffroyi (black-handed spider monkey) precursor microRNA let-7a-1
  3. Bos taurus let-7a-1 stem-loop (bta-let-7a-1)
  4. Capra hircus microRNA let-7a-1 (ENSCHIG00000009519.1)
  5. Carlito syrichta miRNA (ENSTSYG00000021072.2)
  6. Cebus imitator microRNA let-7a-1 (ENSCCAG00000005244.1)
  7. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000010054.1)
  8. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000008020.1)
  9. Echinops telfairi (small Madagascar hedgehog) miRNA (ENSETEG00000021920.1)
  10. Gorilla gorilla precursor microRNA let-7a-1
  11. Homo sapiens let-7a-1 stem-loop (hsa-let-7a-1)
  12. Lagothrix lagotricha (brown woolly monkey) precursor microRNA let-7a-1
  13. Lemur catta (Ring-tailed lemur) precursor microRNA let-7a-1
  14. Macaca mulatta let-7a-1 stem-loop (mml-let-7a-1)
  15. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000010971.1)
  16. Mandrillus leucophaeus miRNA (ENSMLEG00000004753.1)
  17. Microcebus murinus (gray mouse lemur) microRNA let-7a-1 (ENSMICG00000019650.3)
  18. Myotis lucifugus miRNA (ENSMLUG00000018054.1)
  19. Nomascus leucogenys miRNA (ENSNLEG00000027736.1, ENSNLEG00000034490.1)
  20. Oryctolagus cuniculus (rabbit) ocu-let-7a-1 (ENSOCUG00000018323.1)
  21. Pan paniscus microRNA let-7a-1 (ENSPPAG00000007576.1)
  22. Panthera pardus (leopard) microRNA let-7a-1 (ENSPPRG00000013995.1)
  23. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000002647.1)
  24. Pan troglodytes ptr-let-7a-1 (ENSPTRG00000027844.4)
  25. Pongo abelii miRNA
  26. Pongo pygmaeus let-7a-1 stem-loop (ppy-let-7a-1)
  27. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000011738.1)
  28. Pteropus vampyrus miRNA (ENSPVAG00000025480.1)
  29. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000007863.1)
  30. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000024057.1)
  31. Saguinus labiatus precursor microRNA let-7a-1
  32. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000019121.1)
  33. Sorex araneus (European shrew) miRNA (ENSSARG00000016564.1)
  34. Suricata suricatta microRNA let-7a-1 (ENSSSUG00005021949.1)
  35. Tursiops truncatus (bottlenosed dolphin) miRNA (ENSTTRG00000022643.1)
  36. Vicugna pacos miRNA (ENSVPAG00000016957.1)
Publications