Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000019121.1) URS00005EB5B7_39432

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 35 other species

    1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000002894.1)
    2. Ateles geoffroyi (black-handed spider monkey) precursor microRNA let-7a-1
    3. Bos taurus let-7a-1 stem-loop (bta-let-7a-1)
    4. Capra hircus miRNA (ENSCHIG00000009519.1)
    5. Carlito syrichta miRNA (ENSTSYG00000021072.2)
    6. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000010054.1)
    7. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000008020.1)
    8. Echinops telfairi (small Madagascar hedgehog) miRNA (ENSETEG00000021920.1)
    9. Gorilla gorilla gorilla microRNA let-7a-1 (ENSGGOG00000030966.2)
    10. Gorilla gorilla (western gorilla) precursor microRNA let-7a-1
    11. Homo sapiens let-7a-1 stem-loop (hsa-let-7a-1)
    12. Lagothrix lagotricha precursor microRNA let-7a-1
    13. Lemur catta (Ring-tailed lemur) precursor microRNA let-7a-1
    14. Macaca mulatta let-7a-1 stem-loop (mml-let-7a-1)
    15. Macaca nemestrina miRNA (ENSMNEG00000010971.1)
    16. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000004753.1)
    17. Microcebus murinus (gray mouse lemur) miRNA MIRLET7A1 (ENSMICG00000019650.3)
    18. Myotis lucifugus (little brown bat) miRNA (ENSMLUG00000018054.1)
    19. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA (ENSNLEG00000027736.1, ENSNLEG00000034490.1)
    20. Oryctolagus cuniculus (rabbit) ocu-let-7a-1 (ENSOCUG00000018323.1)
    21. Pan paniscus miRNA MIRLET7A1 (ENSPPAG00000007576.1)
    22. Panthera pardus (leopard) miRNA (ENSPPRG00000013995.1)
    23. Panthera tigris altaica miRNA (ENSPTIG00000002647.1)
    24. Pan troglodytes (chimpanzee) ptr-let-7a-1 (ENSPTRG00000027844.4)
    25. Pongo abelii (Sumatran orangutan) miRNA
    26. Pongo pygmaeus let-7a-1 stem-loop (ppy-let-7a-1)
    27. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000011738.1)
    28. Pteropus vampyrus (large flying fox) miRNA (ENSPVAG00000025480.1)
    29. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000007863.1)
    30. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000024057.1)
    31. Saguinus labiatus (red-chested mustached tamarin) precursor microRNA let-7a-1
    32. Sorex araneus miRNA (ENSSARG00000016564.1)
    33. Suricata suricatta (meerkat) microRNA let-7a-1 (ENSSSUG00005021949.1)
    34. Tursiops truncatus (bottlenosed dolphin) miRNA (ENSTTRG00000022643.1)
    35. Vicugna pacos (alpaca) miRNA (ENSVPAG00000016957.1)
    36. Cebus imitator None