Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-493 URS00005E7CB2_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-493: Bta-mir-493 is a known miRNA that has been identified in various studies [PMC5821052]. It is one of the miRNAs that were found to be exclusive to the ovary follicles (OF) [PMC9594899]. In a study investigating the regulatory relationships of circRNAs, it was found that circRNA_02728 had a regulatory relationship with bta-mir-493 [PMC8946036]. Bta-mir-493 is also a precursor of TCONS_00284825 [PMC5608193]. In another study, bta-mir-493 was selected for qRT-PCR to verify RNA-seq results [PMC9613354]. Furthermore, in an analysis comparing udder parenchyma tissue infected with CoNS to a control group, bta-mir-493 was found to be differentially expressed, with an upregulated expression level [PMC7937231]. Additionally, bta-mir-493 has been found to have higher expression levels in mature testicular tissue [PMC8614260]. In summary, bta-mir-493 is a known miRNA that has been identified in various studies and has been found to have different regulatory relationships and expression levels in different tissues. It is one of the miRNAs exclusive to ovary follicles and has been shown to be differentially expressed in udder parenchyma tissue infected with CoNS. Furthermore, it has higher expression levels in mature testicular tissue.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAAGGUCUACUGUGUGCCAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Publications