Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saccharomyces cerevisiae S288C RNA of unknown function transcribed by RNA polymerase III URS00005E3537_559292

  • 169 nucleotides
  • 3 databases (ENA, RefSeq, SGD)
  • Found in 29 species
  • ncRNA

Automated summary: This sRNA sequence is 169 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 3 databases (SGD, ENA, RefSeq). Described in 12 papers. Saccharomyces cerevisiae S288C RNA of unknown function transcribed by RNA polymerase III sequence is a product of RNA170 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUCUCUUAUAUACCAUGGCGCUGCAGAUCUAUCCAAAUUCUUCCAUACUGAAAAUCAUCCAAACGAGAACGAUAGCACCGGUAGUUUUCCUUGCGGCUUAUACGAGGGCCGUGGUUCGAUUCUGCCCUGGAGCGUAAGGGCAGGAAUGUGCAUUGCAUAAGAUCAUAAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 28 other species

    1. Saccharomyces cerevisiae RNA170
    2. Saccharomyces cerevisiae P283 SNR11
    3. Saccharomyces cerevisiae P301 SNR11
    4. Saccharomyces cerevisiae R008 SNR11
    5. Saccharomyces cerevisiae R103 SNR11
    6. Saccharomyces cerevisiae YJM1326 RNA170
    7. Saccharomyces cerevisiae YJM1332 RNA170
    8. Saccharomyces cerevisiae YJM1336 RNA170
    9. Saccharomyces cerevisiae YJM1381 RNA170
    10. Saccharomyces cerevisiae YJM1383 RNA170
    11. Saccharomyces cerevisiae YJM1415 RNA170
    12. Saccharomyces cerevisiae YJM1417 RNA170
    13. Saccharomyces cerevisiae YJM1433 RNA170
    14. Saccharomyces cerevisiae YJM1444 RNA170
    15. Saccharomyces cerevisiae YJM1463 RNA170
    16. Saccharomyces cerevisiae YJM1478 RNA170
    17. Saccharomyces cerevisiae YJM1526 RNA170
    18. Saccharomyces cerevisiae YJM1549 RNA170
    19. Saccharomyces cerevisiae YJM193 RNA170
    20. Saccharomyces cerevisiae YJM244 RNA170
    21. Saccharomyces cerevisiae YJM271 RNA170
    22. Saccharomyces cerevisiae YJM326 RNA170
    23. Saccharomyces cerevisiae YJM428 RNA170
    24. Saccharomyces cerevisiae YJM541 RNA170
    25. Saccharomyces cerevisiae YJM554 RNA170
    26. Saccharomyces cerevisiae YJM682 RNA170
    27. Saccharomyces cerevisiae YJM683 RNA170
    28. Saccharomyces cerevisiae YJM689 RNA170