Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Lytechinus variegatus (green sea urchin) lva-miR-184-3p URS00005DFDA7_7654

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

lva-mir-184: Lva-mir-184 is a miRNA that has been studied in various contexts. In a study evaluating the expression of VPAHPND-responsive miRNAs, the expression level of lva-mir-184 remained unchanged at 6 and 24 hours post-infection [PMC7884684]. Another study focused on heat stress in Litopenaeus vannamei identified lva-mir-184 as one of the differentially expressed miRNAs [PMC9351827]. Additionally, lva-mir-184 was identified as one of the unique NLHS-VP-responsive miRNAs in another study [PMC6972907]. In this same study, lva-mir-184 was found to be a differentially expressed miRNA along with other homologs such as lva-let-7 and lva-miR-9 [PMC6972907]. The expression analysis of selected miRNAs, including lva-mir-184, was conducted using stem-loop RT-qPCR [PMC6972907]. Furthermore, in order to confirm the presence and analyze the expression profiles of interesting L. vannamei miRNAs in response to VPAHPND infection under NLHS and control conditions, the expression of lva-mir-184 was analyzed using RT-qPCR along with other selected DEMs and DEGs [PMC6972907]. Overall, these studies highlight the presence and differential expression of lva-mir-184 in various contexts.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGACGGAGAACUGAUAAGGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 68 other species

  1. Acyrthosiphon pisum api-miR-184a
  2. Aedes aegypti aae-miR-184
  3. Apis mellifera ame-miR-184-3p
  4. Bactrocera dorsalis (oriental fruit fly) bdo-miR-184
  5. Blattella germanica Bge-Mir-184_3p (mature (guide))
  6. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-184-3p
  7. Callorhinchus milii (elephant shark) Cmi-Mir-184_3p (mature (guide))
  8. Capitella teleta cte-miR-184a
  9. Centruroides sculpturatus (bark scorpion) Csc-Mir-184-P25_3p (mature (guide))
  10. Ciona intestinalis (vase tunicate) cin-miR-184
  11. Cochliomyia hominivorax mature cho-miR-184-3p
  12. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-184-3p
  13. Crassostrea gigas (Pacific oyster) Cgi-Mir-184-P7_3p (mature (guide))
  14. Culex quinquefasciatus cqu-miR-184
  15. Cyprinus carpio ccr-miR-184
  16. Danio rerio dre-miR-184
  17. Daphnia magna Dma-Mir-184_3p (mature (guide))
  18. Daphnia pulex (common water flea) Dpu-Mir-184_3p (mature (guide))
  19. Drosophila ananassae dan-miR-184-3p
  20. Drosophila erecta der-miR-184-3p
  21. Drosophila grimshawi dgr-miR-184-3p
  22. Drosophila melanogaster (fruit fly) dme-miR-184-3p
  23. Drosophila mojavensis dmo-miR-184-3p
  24. Drosophila persimilis dpe-miR-184-3p
  25. Drosophila pseudoobscura dps-miR-184
  26. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294415_df_nrg
  27. Drosophila sechellia dse-miR-184-3p
  28. Drosophila simulans dsi-miR-184-3p
  29. Drosophila virilis dvi-miR-184-3p
  30. Drosophila willistoni dwi-miR-184-3p
  31. Drosophila yakuba dya-miR-184-3p
  32. Eisenia fetida (common brandling worm) Efe-Mir-184-o2_3p (mature (guide))
  33. Euprymna scolopes Esc-Mir-184_3p (mature (guide))
  34. Gadus morhua Gmo-Mir-184-P2_3p (mature (guide))
  35. Haplochromis burtoni abu-miR-184a
  36. Heliconius melpomene hme-miR-184
  37. Ictalurus punctatus (channel catfish) ipu-miR-184
  38. Ixodes scapularis isc-miR-184
  39. Lepisosteus oculatus (spotted gar) Loc-Mir-184_3p (mature (guide))
  40. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-184-P20_3p (mature (guide))
  41. Lingula anatina Lan-Mir-184_3p (mature (guide))
  42. Lottia gigantea (owl limpet) lgi-miR-184
  43. Manduca sexta (tobacco hornworm) mse-miR-184
  44. Maylandia zebra mze-miR-184a
  45. Melibe leonina mle-miR-184-3p
  46. Monopterus albus Mal-Mir-184-P2_3p (mature (guide))
  47. Mus musculus Mus_musculus piRNA piR-mmu-49530790
  48. Nasonia giraulti ngi-miR-184
  49. Nasonia longicornis nlo-miR-184
  50. Nasonia vitripennis (jewel wasp) nvi-miR-184
  51. Nautilus pompilius Npo-Mir-184_3p (mature (guide))
  52. Neolamprologus brichardi (lyretail cichlid) nbr-miR-184a
  53. Octopus bimaculoides Obi-Mir-184-P26_3p (mature (guide))
  54. Octopus vulgaris (common octopus) Ovu-Mir-184-P26_3p (mature (guide))
  55. Oreochromis niloticus oni-miR-184a
  56. Parasteatoda tepidariorum pte-miR-184-3p
  57. Patiria miniata (sea bat) pmi-miR-184-3p
  58. Penaeus japonicus miR-184
  59. Polistes canadensis pca-miR-184-3p
  60. Pundamilia nyererei pny-miR-184a
  61. Saccoglossus kowalevskii sko-miR-184-3p
  62. Scyliorhinus torazame (cloudy catshark) Sto-Mir-184_3p (mature (guide))
  63. Strongylocentrotus purpuratus (purple sea urchin) spu-miR-184
  64. Tetranychus urticae (two-spotted spider mite) tur-miR-184-3p
  65. Tetraodon nigroviridis Tni-Mir-184-P2_3p (mature (guide))
  66. Tor tambroides (Thai mahseer) miR-184
  67. Tribolium castaneum tca-miR-184-3p
  68. Triops cancriformis tcf-miR-184-3p
Publications