v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Aedes aegypti (yellow fever mosquito) aae-miR-184 URS00005DFDA7_7159

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

aae-mir-184: Aae-mir-184 is a microRNA that is differentially expressed post-infection in mosquitoes and plays a role in regulating viral replication at the initial site of infection [PMC4303268]. In CHIKV-infected Ae.albopictus saliva, aae-mir-2940 was downregulated, while aae-mir-125, aae-mir-263a, aae-mir-184, and aae-mir-100 were upregulated compared to uninfected saliva [PMC4303268]. Similarly, in CHIKV-infected Ae.aegypti saliva, aae-mir-184 was downregulated compared to uninfected saliva [PMC4303268]. The highest read counts in CHIKV-infected Ae.albopictus saliva were observed for aae-mir-125, aae-mir-263a, aae-mir-8, aae-mir-184, and aae-mir-100 [PMC4303268]. Interestingly, the same miRNAs were highly expressed in both Ae.albopictus and Ae.aegypti saliva [PMC4303268]. These miRNAs include not only the aforementioned ones but also others such as aae-mir-bantam and aae-miR281 [PMC4303268]. In uninfected Ae.aegypti saliva, highly expressed miRNAs included not only the aforementioned ones but also others such as aaemirm-bantam and aaemirm281 [PMC4303268].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGACGGAGAACUGAUAAGGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 68 other species

  1. Acyrthosiphon pisum api-miR-184a
  2. Apis mellifera ame-miR-184-3p
  3. Bactrocera dorsalis (oriental fruit fly) bdo-miR-184
  4. Blattella germanica Bge-Mir-184_3p (mature (guide))
  5. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-184-3p
  6. Callorhinchus milii (elephant shark) Cmi-Mir-184_3p (mature (guide))
  7. Capitella teleta cte-miR-184a
  8. Centruroides sculpturatus (bark scorpion) Csc-Mir-184-P25_3p (mature (guide))
  9. Ciona intestinalis (vase tunicate) cin-miR-184
  10. Cochliomyia hominivorax mature cho-miR-184-3p
  11. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-184-3p
  12. Crassostrea gigas (Pacific oyster) Cgi-Mir-184-P7_3p (mature (guide))
  13. Culex quinquefasciatus cqu-miR-184
  14. Cyprinus carpio ccr-miR-184
  15. Danio rerio dre-miR-184
  16. Daphnia magna Dma-Mir-184_3p (mature (guide))
  17. Daphnia pulex (common water flea) Dpu-Mir-184_3p (mature (guide))
  18. Drosophila ananassae dan-miR-184-3p
  19. Drosophila erecta der-miR-184-3p
  20. Drosophila grimshawi dgr-miR-184-3p
  21. Drosophila melanogaster (fruit fly) dme-miR-184-3p
  22. Drosophila mojavensis dmo-miR-184-3p
  23. Drosophila persimilis dpe-miR-184-3p
  24. Drosophila pseudoobscura dps-miR-184
  25. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294415_df_nrg
  26. Drosophila sechellia dse-miR-184-3p
  27. Drosophila simulans dsi-miR-184-3p
  28. Drosophila virilis dvi-miR-184-3p
  29. Drosophila willistoni dwi-miR-184-3p
  30. Drosophila yakuba dya-miR-184-3p
  31. Eisenia fetida (common brandling worm) Efe-Mir-184-o2_3p (mature (guide))
  32. Euprymna scolopes Esc-Mir-184_3p (mature (guide))
  33. Gadus morhua Gmo-Mir-184-P2_3p (mature (guide))
  34. Haplochromis burtoni abu-miR-184a
  35. Heliconius melpomene hme-miR-184
  36. Ictalurus punctatus (channel catfish) ipu-miR-184
  37. Ixodes scapularis isc-miR-184
  38. Lepisosteus oculatus (spotted gar) Loc-Mir-184_3p (mature (guide))
  39. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-184-P20_3p (mature (guide))
  40. Lingula anatina Lan-Mir-184_3p (mature (guide))
  41. Lottia gigantea (owl limpet) lgi-miR-184
  42. Lytechinus variegatus lva-miR-184-3p
  43. Manduca sexta (tobacco hornworm) mse-miR-184
  44. Maylandia zebra mze-miR-184a
  45. Melibe leonina mle-miR-184-3p
  46. Monopterus albus Mal-Mir-184-P2_3p (mature (guide))
  47. Mus musculus Mus_musculus piRNA piR-mmu-49530790
  48. Nasonia giraulti ngi-miR-184
  49. Nasonia longicornis nlo-miR-184
  50. Nasonia vitripennis (jewel wasp) nvi-miR-184
  51. Nautilus pompilius Npo-Mir-184_3p (mature (guide))
  52. Neolamprologus brichardi (lyretail cichlid) nbr-miR-184a
  53. Octopus bimaculoides Obi-Mir-184-P26_3p (mature (guide))
  54. Octopus vulgaris (common octopus) Ovu-Mir-184-P26_3p (mature (guide))
  55. Oreochromis niloticus oni-miR-184a
  56. Parasteatoda tepidariorum pte-miR-184-3p
  57. Patiria miniata (sea bat) pmi-miR-184-3p
  58. Penaeus japonicus miR-184
  59. Polistes canadensis pca-miR-184-3p
  60. Pundamilia nyererei pny-miR-184a
  61. Saccoglossus kowalevskii sko-miR-184-3p
  62. Scyliorhinus torazame (cloudy catshark) Sto-Mir-184_3p (mature (guide))
  63. Strongylocentrotus purpuratus (purple sea urchin) spu-miR-184
  64. Tetranychus urticae (two-spotted spider mite) tur-miR-184-3p
  65. Tetraodon nigroviridis Tni-Mir-184-P2_3p (mature (guide))
  66. Tor tambroides (Thai mahseer) miR-184
  67. Tribolium castaneum tca-miR-184-3p
  68. Triops cancriformis tcf-miR-184-3p
 Publications