Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila yakuba dya-miR-184-3p URS00005DFDA7_7245

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Drosophila yakuba. Annotated by 2 databases (miRBase, Ensembl Metazoa). Described in 1 paper. Drosophila yakuba dya-miR-184-3p sequence is a product of FBtr0298713_df_nrg gene. Found in the Drosophila yakuba reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGACGGAGAACUGAUAAGGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 55 other species

    1. Acyrthosiphon pisum (pea aphid) api-miR-184a
    2. Aedes aegypti aae-miR-184
    3. Apis mellifera (honey bee) ame-miR-184-3p
    4. Bactrocera dorsalis (oriental fruit fly) bdo-miR-184
    5. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-184-3p
    6. Capitella teleta cte-miR-184a
    7. Ciona intestinalis cin-miR-184
    8. Cochliomyia hominivorax mature cho-miR-184-3p
    9. Cochliomyia macellaria mature cma-miR-184-3p
    10. Crassostrea gigas Cgi-Mir-184-P7_3p (mature (guide))
    11. Culex quinquefasciatus (southern house mosquito) cqu-miR-184
    12. Cyprinus carpio (common carp) ccr-miR-184
    13. Danio rerio dre-miR-184
    14. Daphnia pulex Dpu-Mir-184_3p (mature (guide))
    15. Dasypus novemcinctus Dan-Mir-184_3p (mature (guide))
    16. Drosophila ananassae dan-miR-184-3p
    17. Drosophila erecta der-miR-184-3p
    18. Drosophila grimshawi dgr-miR-184-3p
    19. Drosophila melanogaster (fruit fly) dme-miR-184-3p
    20. Drosophila mojavensis dmo-miR-184-3p
    21. Drosophila persimilis dpe-miR-184-3p
    22. Drosophila pseudoobscura dps-miR-184
    23. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294415_df_nrg
    24. Drosophila sechellia dse-miR-184-3p
    25. Drosophila simulans dsi-miR-184-3p
    26. Drosophila virilis dvi-miR-184-3p
    27. Drosophila willistoni dwi-miR-184-3p
    28. Eisenia fetida Efe-Mir-184-o2_3p (mature (guide))
    29. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-184a
    30. Heliconius melpomene (postman butterfly) hme-miR-184
    31. Ictalurus punctatus ipu-miR-184
    32. Ixodes scapularis (black-legged tick) isc-miR-184
    33. Lingula anatina Lan-Mir-184_3p (mature (guide))
    34. Lottia gigantea (owl limpet) lgi-miR-184
    35. Lytechinus variegatus lva-miR-184-3p
    36. Manduca sexta mse-miR-184
    37. Maylandia zebra (zebra mbuna) mze-miR-184a
    38. Melibe leonina mle-miR-184-3p
    39. Mus musculus Mus_musculus piRNA piR-mmu-49530790
    40. Nasonia giraulti ngi-miR-184
    41. Nasonia longicornis nlo-miR-184
    42. Nasonia vitripennis nvi-miR-184
    43. Neolamprologus brichardi nbr-miR-184a
    44. Oreochromis niloticus oni-miR-184a
    45. Parasteatoda tepidariorum (common house spider) pte-miR-184-3p
    46. Patiria miniata pmi-miR-184-3p
    47. Penaeus japonicus miR-184
    48. Polistes canadensis pca-miR-184-3p
    49. Pundamilia nyererei pny-miR-184a
    50. Saccoglossus kowalevskii sko-miR-184-3p
    51. Scyliorhinus torazame Sto-Mir-184_3p (mature (guide))
    52. Strongylocentrotus purpuratus spu-miR-184
    53. Tetranychus urticae (two-spotted spider mite) tur-miR-184-3p
    54. Tor tambroides (Thai mahseer) miR-184
    55. Tribolium castaneum (red flour beetle) tca-miR-184-3p
    56. Triops cancriformis tcf-miR-184-3p