Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Parasteatoda tepidariorum (common house spider) pte-miR-184-3p URS00005DFDA7_114398

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Parasteatoda tepidariorum. Annotated by 1 database (miRBase). Described in 0 papers.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGACGGAGAACUGAUAAGGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 72 other species

    1. Acyrthosiphon pisum api-miR-184a
    2. Aedes aegypti aae-miR-184
    3. Apis mellifera ame-miR-184-3p
    4. Bactrocera dorsalis bdo-miR-184
    5. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-184-3p
    6. Capitella teleta cte-miR-184a
    7. Ciona intestinalis cin-miR-184
    8. Cochliomyia hominivorax mature cho-miR-184-3p
    9. Cochliomyia macellaria mature cma-miR-184-3p
    10. Crassostrea gigas Cgi-Mir-184-P7_3p (mature (guide))
    11. Culex quinquefasciatus (southern house mosquito) cqu-miR-184
    12. Cyprinus carpio (common carp) ccr-miR-184
    13. Danio rerio dre-miR-184
    14. Daphnia pulex Dpu-Mir-184_3p (mature (guide))
    15. Dasypus novemcinctus Dan-Mir-184_3p (mature (guide))
    16. Drosophila ananassae dan-miR-184-3p
    17. Drosophila erecta der-miR-184-3p
    18. Drosophila grimshawi dgr-miR-184-3p
    19. Drosophila melanogaster (fruit fly) dme-miR-184-3p
    20. Drosophila mojavensis dmo-miR-184-3p
    21. Drosophila persimilis dpe-miR-184-3p
    22. Drosophila pseudoobscura dps-miR-184
    23. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294415_df_nrg
    24. Drosophila sechellia dse-miR-184-3p
    25. Drosophila simulans dsi-miR-184-3p
    26. Drosophila virilis dvi-miR-184-3p
    27. Drosophila willistoni dwi-miR-184-3p
    28. Drosophila yakuba dya-miR-184-3p
    29. Eisenia fetida (common brandling worm) Efe-Mir-184-o2_3p (mature (guide))
    30. Haplochromis burtoni abu-miR-184a
    31. Heliconius melpomene hme-miR-184
    32. Ictalurus punctatus ipu-miR-184
    33. Ixodes scapularis (black-legged tick) isc-miR-184
    34. Lingula anatina Lan-Mir-184_3p (mature (guide))
    35. Lottia gigantea (owl limpet) lgi-miR-184
    36. Lytechinus variegatus lva-miR-184-3p
    37. Manduca sexta mse-miR-184
    38. Maylandia zebra mze-miR-184a
    39. Melibe leonina mle-miR-184-3p
    40. Mus musculus Mus_musculus piRNA piR-mmu-49530790
    41. Nasonia giraulti ngi-miR-184
    42. Nasonia longicornis nlo-miR-184
    43. Nasonia vitripennis (jewel wasp) nvi-miR-184
    44. Neolamprologus brichardi nbr-miR-184a
    45. Oreochromis niloticus oni-miR-184a
    46. Patiria miniata pmi-miR-184-3p
    47. Penaeus japonicus miR-184
    48. Polistes canadensis pca-miR-184-3p
    49. Pundamilia nyererei pny-miR-184a
    50. Saccoglossus kowalevskii sko-miR-184-3p
    51. Scyliorhinus torazame (cloudy catshark) Sto-Mir-184_3p (mature (guide))
    52. Strongylocentrotus purpuratus spu-miR-184
    53. Tetranychus urticae (two-spotted spider mite) tur-miR-184-3p
    54. Tor tambroides miR-184
    55. Tribolium castaneum (red flour beetle) tca-miR-184-3p
    56. Triops cancriformis tcf-miR-184-3p