Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-193a-3p URS00005DBAF3_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (LncBase, MirGeneDB, PSICQUIC, miRBase, ENA, TarBase, RefSeq, MalaCards, IntAct, GeneCards). Described in 72 papers. Homo sapiens (human) hsa-miR-193a-3p sequence is a product of miR-193, hsa-miR-193a-3p, hsa-miR-193a, miR-193a, MIR193A, miR-193a-3p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 11B6, 182-FIP, 53BP2, 82-FIP, A121, A170, A43, A6RP, A6r, ABCC10.

Interactions 11

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-193a-3p interacts with:

Interaction id Participant Synonyms
EBI-26362731 intact:EBI-26362881 EBI-26362881 ENST00000445327 mrna_grb7
URS00005DBAF3_9606-0 P04156 P04156
URS00005DBAF3_9606-5 P04156 P04156
URS00005DBAF3_9606-1 P09429 P09429
URS00005DBAF3_9606-6 P09429 P09429
URS00005DBAF3_9606-2 P49768 P49768
URS00005DBAF3_9606-7 P49768 P49768
URS00005DBAF3_9606-3 Q07820 Q07820
URS00005DBAF3_9606-8 Q07820 Q07820
URS00005DBAF3_9606-9 Q9Y4L1 Q9Y4L1
URS00005DBAF3_9606-4 Q9Y4L1 Q9Y4L1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AACUGGCCUACAAAGUCCCAGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 63 other species

    1. Alligator mississippiensis Ami-Mir-193-P1a_3p (mature (co-guide))
    2. Anolis carolinensis Aca-Mir-193-P1a_3p* (star (passenger))
    3. Bos taurus (cattle) bta-miR-193a-3p
    4. Canis lupus familiaris (dog) Cfa-Mir-193-P1a_3p* (star (passenger))
    5. Cavia porcellus cpo-miR-193a-3p
    6. Chrysemys picta bellii Cpi-Mir-193-P1a_3p* (star (passenger))
    7. Cricetulus griseus (Chinese hamster) cgr-miR-193a
    8. Cyprinus carpio (common carp) ccr-miR-193a
    9. Danio rerio dre-miR-193a-3p
    10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-193a-3p
    11. Echinops telfairi Ete-Mir-193-P1a_3p (mature (guide))
    12. Eptesicus fuscus (big brown bat) efu-miR-193a
    13. Equus caballus eca-miR-193a-3p
    14. Gallus gallus (chicken) gga-miR-193a-3p
    15. Haplochromis burtoni abu-miR-193-3p
    16. Macaca mulatta mml-miR-193a-3p
    17. Maylandia zebra (zebra mbuna) mze-miR-193
    18. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-193-P1a_3p* (star (passenger))
    19. Mus musculus mmu-miR-193a-3p
    20. Neolamprologus brichardi nbr-miR-193
    21. Ophiophagus hannah oha-miR-193-3p
    22. Oreochromis niloticus (Nile tilapia) oni-miR-193
    23. Oryctolagus cuniculus ocu-miR-193a-3p
    24. Otolemur garnettii oga-miR-193a
    25. Pan paniscus ppa-miR-193a
    26. Pan troglodytes (chimpanzee) ptr-miR-193a
    27. Papio hamadryas pha-miR-193a
    28. Pongo pygmaeus ppy-miR-193a-3p
    29. Pteropus alecto (black flying fox) pal-miR-193a-3p
    30. Python bivittatus pbv-miR-193a-3p
    31. Rattus norvegicus rno-miR-193a-3p
    32. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-193-P1a_3p* (star (passenger))
    33. Sus scrofa ssc-miR-193a-3p
    34. Taeniopygia guttata (zebra finch) Tgu-Mir-193-P1a_3p (mature (guide))
    35. Takifugu rubripes fru-miR-193
    36. Tetraodon nigroviridis tni-miR-193
    37. Tor tambroides miR-193a-3p
    38. Tupaia chinensis (Chinese tree shrew) tch-miR-193a-3p