Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-193a-3p URS00005DBAF3_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 4 databases (MirGeneDB, miRBase, ENA, RefSeq). Danio rerio (zebrafish) dre-miR-193a-3p sequence is a product of miR-193, dre-miR-193a-3p, miR-193a-3p, miR-193a, dre-miR-193a, mir193a-1, mir193a-2 genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AACUGGCCUACAAAGUCCCAGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 38 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-193-P1b_3p (mature (co-guide))
    2. Anolis carolinensis Aca-Mir-193-P1a_3p* (star (passenger))
    3. Bos taurus bta-miR-193a-3p
    4. Canis lupus familiaris (dog) Cfa-Mir-193-P1a_3p* (star (passenger))
    5. Cavia porcellus (domestic guinea pig) cpo-miR-193a-3p
    6. Chrysemys picta bellii Cpi-Mir-193-P1a_3p* (star (passenger))
    7. Cricetulus griseus cgr-miR-193a
    8. Cyprinus carpio (common carp) ccr-miR-193a
    9. Dasypus novemcinctus dno-miR-193a-3p
    10. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-193-P1b_3p (mature (guide))
    11. Eptesicus fuscus (big brown bat) efu-miR-193a
    12. Equus caballus (horse) eca-miR-193a-3p
    13. Gadus morhua (Atlantic cod) Gmo-Mir-193-P1b2_3p (mature (guide))
    14. Gallus gallus gga-miR-193a-3p
    15. Gekko japonicus Gja-Mir-193-P1b_3p (mature (guide))
    16. Haplochromis burtoni abu-miR-193-3p
    17. Homo sapiens hsa-miR-193a-3p
    18. Latimeria chalumnae (coelacanth) Lch-Mir-193-P1b_3p (mature (guide))
    19. Macaca mulatta mml-miR-193a-3p
    20. Maylandia zebra mze-miR-193
    21. Microcaecilia unicolor Mun-Mir-193-P1b_3p (mature (guide))
    22. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-193-P1a_3p* (star (passenger))
    23. Monopterus albus (swamp eel) Mal-Mir-193-P1b2_3p (mature (guide))
    24. Mus musculus (house mouse) mmu-miR-193a-3p
    25. Neolamprologus brichardi nbr-miR-193
    26. Ophiophagus hannah (king cobra) oha-miR-193-3p
    27. Oreochromis niloticus oni-miR-193
    28. Oryctolagus cuniculus ocu-miR-193a-3p
    29. Otolemur garnettii (small-eared galago) oga-miR-193a
    30. Pan paniscus (pygmy chimpanzee) ppa-miR-193a
    31. Pan troglodytes ptr-miR-193a
    32. Papio hamadryas pha-miR-193a
    33. Pongo pygmaeus ppy-miR-193a-3p
    34. Pteropus alecto (black flying fox) pal-miR-193a-3p
    35. Python bivittatus pbv-miR-193a-3p
    36. Rattus norvegicus (Norway rat) rno-miR-193a-3p
    37. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-193-P1a_3p* (star (passenger))
    38. Sus scrofa ssc-miR-193a-3p
    39. Taeniopygia guttata (zebra finch) Tgu-Mir-193-P1b_3p (mature (guide))
    40. Takifugu rubripes (torafugu) fru-miR-193
    41. Tetraodon nigroviridis tni-miR-193
    42. Tor tambroides miR-193a-3p
    43. Tupaia chinensis (Chinese tree shrew) tch-miR-193a-3p
    Publications New