v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1281 (LINC01281) URS00005DB5CD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01281: LINC01281 is a long non-coding RNA (lncRNA) that has been shown to enhance the migration capacity of T cells towards tumor cells [PMC9626207]. In a study, eight immune-associated lncRNA signatures were identified, including LINC01281, which were found to have differential expression levels in different risk groups [PMC8435534]. LINC01281 has also been reported to modulate the overall survival rate of patients with laryngeal squamous cell carcinoma by activating the Wnt signaling pathway, which is important for cellular proliferation, migration, and apoptosis [PMC8645855]. Furthermore, LINC01281 expression was included in a risk score calculation for patients with head and neck squamous cell carcinoma (HNSCC) [PMC9270212]. In this calculation, higher expression levels of LINC01281 were associated with a lower risk score. Additionally, analysis identified LINC01281 as a potential biomarker for patients with HNSCC [PMC8645855]. Overall, these findings suggest that LINC01281 plays a role in T cell migration towards tumor cells and may have prognostic value in HNSCC.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAGGCAGCCAUGGUAUUGACAGAAAAAGACUCUGGAUUUGGAUUGCAGCUGUAGCAUUUAUUAAAUGCACGUCACAACCUCUCUGAGCUUCGUUUUCCCCACGUUUCAAAUGGGAUGCAGUGGACCCUGUUGCCUACCCGAGAACAACUUCAAAGCAACUUUGAGAGCCUUGUAUGGAAGAUGGCAACUUUGAGAGCCUUGUGUUGAAGAUGGCAAAGCCACAAGAUGGAAAGUGCUUGGGUUCUUGGAUCAUUGUAUGGAGGGGUUCUGCCCAACUAGGAUCACCCAGGCUGGAUUGUCAUCAAAGAAUUGGGUCCUGAAAGUAGCAUACUCAAUGGGGACUGUGAGCAUGCAUCACUUAAUCAGUACAUUGGCACUCCACUCCCUCCUGGGCCAGAUUGUAUGUAGGUCAACACCUCCAGUGGCUGAACCUCCAGAAGGGCUAUCACAAAGGUCUGAGAAUCUGUCUCCCUUAAGGCAGCGAGAAGUGGUCACAGACACGGCUUGGCUGCUAGCAUGGCAGAAGGUCUAGUGGGGGCAGCUGGGACUCCACCAGCCCAGAGUGAAGAUAAGAAUACCUAUUUUAAAGUUCUGUUGUGAGGUUCAAGUGCCACAUAUGGGGCCACCAGAAGCUGUUGGCGCCCCUCCCACAUCCCUGUGGUCCACUCAGGAGGUUAACUGCAGUCAGCUGUCAUUCUGCUGGUGGCUUCCUGCGUCUUUCUGCCUGAGCUUGUUCUUUGGCCCUGGAGGAACCCUCCACCAAUGAGAGAUGGGAAUUGUUGGAUAAAAGUCCCAGCUUCCACUCCAAGGCAUGUUCAUGAUCCAUGCAGCCUCUGAGAGGCCUCCCAUGGGCCUGAGCCCCAGUUGCCCACACUGGUAAUACACACAUCUGCUCACUCUCCACUGGCUUUCCUCUCUCCCUUUCUCACUGCUUCACCUUCCCAAUGUGCCUCCUGGACCACGUCCCAAAUAAAUGAUUGCACUCAAAUCCUCGUCUUGGGGUCUGCUAAGGGGAAAUCCAAGUCCAGACAUUGGUAUGACUCAAGUGCUUAAUAAAUAGACCAUGUCACUAUUGUAGUUUCUAGAUACCCAAAAUUCAAAUGUGGGUCUCUCUGCUUAUAUUUUGUAUUUUCUAUGUAAAAAAUUCCCUAAAGCCCUCCAGGAAGGACUCCUCUCCCUGUGGCUCCAUGCCAGUCCUAUGCUCUGCAGCCAUAGGGAGGAUUGCUGUGCCAAUGCUCACAAACCUUGGGGCUGCCAUCCCCAAGACUCCUUGGACUCCAUACAAAGAUUGACCUUAGGAGGAGUGAGUCACAACAACUCCAUGUGAGUAUUGGGAGGCUUUAUAGGUUGAAUUAUGACUUUCCAAAGAGAUUUGUCUUAAACCACAAUUCCUUAAAAUGUGAUCUUAUUAGGCAACAGGGUCUUUGCAAAUGAAAGUUAAGAUGAAGUCAUUAGUGUGGUCCCCAAUUCAACAUGACUGGUGUCCUUAUUAAAAGUGGAGAUUUGGACACAGAAAGACACAAACAAGGAGAACACCAUGUGAAGAUUGGGAUCAUGUGACCAAAAGCCAAGGAACUACCAGAAGGUAAGAGAGAAGACCAGGAACAAAUCCUUUCCUAGUGCCUUCAGAGGGAGUGUGACCUAGUUGACACCUUGAUUUUGGACUUCUAGCCUCUGAAAUUGUGAGACAAUAAAUGCCUGUUGUUUAAGCCACCCAGCUUGUGGCACUUUGUUACAUCAGCCCUACCAGACUAAUAAAGGGGAAUUGUCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications