Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4454 URS00005D12AC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4454: Hsa-mir-4454 is consistently higher in obesity compared to thin individuals [48]. Hsa-miR-582-5p is down-regulated in the visceral adipose tissues-derived exosomes of obese patients [49] [PMC9933125]. Some hsa-mir-4454 reads display heterogenous 5' ends that differ from the annotated genomic locus, but match the sequence of tRNAHis [PMC6675128]. Hsa-mir-4454 and hsa-miR-7975, which were validated in a discovery cohort, failed to validate in an independent patient cohort [PMC7708817]. Hsa-mir-4454 is up-regulated in plasma-derived exosomes from normal Bactrian camels, along with other differentially expressed miRNAs and proteins [PMC9933125]. Hsa-miR-762 is predicted to target Mapk3 and Mapk1, while Fos is predicted as a target of hsa-mir-4454 and rno-miR-144-3p [PMC5709462]. Predicted targets of hsa-mir-4454 include IL10, IL1R1, IL13RA1, IL18BP, IL10RB, and CCR4 [PMC8686203]. Hsa-mir-4454 and hsa-miR7975 have potential diagnostic value in breast cancer cells according to ROC analysis [PMC7005890].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAUCCGAGUCACGGCACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications