Pan troglodytes (chimpanzee) Y RNA (ENSPTRG00000025095.2, ENSPTRG00000049754.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) Y RNA (ENSPTRG00000025095.2, ENSPTRG00000049754.1) URS00005CF03F_9598

102 nucleotides
3 databases (ENA, Ensembl, Rfam)
Found in 15 other species
130 publications
Y RNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GGCUGGUCCGAGUGCAGUGGUGUUUACAACUAAUUGAUCACAACCAGUUACAGAUUUCUUUGUUCCUUCUCCACUCCCACUGCUUCACUUGACUAGCCUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

Aotus nancymaae (Ma's night monkey) Y RNA (ENSANAG00000002815.1, ENSANAG00000012132.1)
Callithrix jacchus Y RNA (ENSCJAG00000081863.1)
Cavia porcellus Y RNA (ENSCPOG00000035422.1)
Gorilla gorilla gorilla Y RNA (ENSGGOG00000031156.2)
Homo sapiens RNA, Ro60-associated Y3 (RNY3)
Ictidomys tridecemlineatus Y RNA (ENSSTOG00000028203.1)
Marmota marmota marmota (Alpine marmot) Y RNA (ENSMMMG00000007105.1)
Marmota monax non-coding RNA
Octodon degus (Degu) Y RNA (ENSODEG00000025700.1)
Pan paniscus (bonobo) Y RNA (ENSPPAG00000000342.1)
Pongo abelii Y RNA (ENSPPYG00000023901.2)
Saimiri boliviensis boliviensis Y RNA (ENSSBOG00000009718.1)
Sciurus vulgaris Y RNA (ENSSVLG00005008211.1)
Spermophilus dauricus (Daurian ground squirrel) Y RNA (ENSSDAG00000014928.1)
Urocitellus parryii Y RNA (ENSUPAG00010020564.1)

2D structure

Publications