Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-191-5p URS00005C2E31_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (TarBase, MirGeneDB, GeneCards, RefSeq, LncBase, miRBase, ENA, PSICQUIC, MalaCards). Described in 70 papers. Homo sapiens (human) hsa-miR-191-5p sequence is a product of miR-191-5p, hsa-miR-191, hsa-miR-191-5p, miR-191, MIR191 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-Cys, 123F2, 14-3-3GAMMA, 14-3-3γ, 182-FIP, 2310047H23Rik, 2H9, 3'OY11.1, 3-PAP, 3D3.

Interactions 3

According to PSICQUIC, Homo sapiens (human) hsa-miR-191-5p interacts with:

Interaction id Participant Synonyms
URS00005C2E31_9606-0 P23560 P23560
URS00005C2E31_9606-1 Q8NBP7 Q8NBP7
URS00005C2E31_9606-2 Q8NBP7 Q8NBP7

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAACGGAAUCCCAAAAGCAGCUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 48 other species

    1. Anolis carolinensis aca-miR-191-5p
    2. Bos taurus (cattle) bta-miR-191
    3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-191
    4. Canis lupus familiaris (dog) Cfa-Mir-191_5p (mature (guide))
    5. Cavia porcellus cpo-miR-191-5p
    6. Chrysemys picta bellii Cpi-Mir-191_5p (mature (guide))
    7. Cricetulus griseus (Chinese hamster) cgr-miR-191-5p
    8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-191-5p
    9. Daubentonia madagascariensis dma-miR-191
    10. Echinops telfairi Ete-Mir-191_5p (mature (guide))
    11. Equus caballus eca-miR-191a
    12. Gallus gallus (chicken) gga-miR-191-5p
    13. Macaca mulatta mml-miR-191-5p
    14. Microcebus murinus (gray mouse lemur) mmr-miR-191
    15. Mus musculus mmu-miR-191-5p
    16. Nomascus leucogenys nle-miR-191
    17. Ophiophagus hannah oha-miR-191-5p
    18. Ornithorhynchus anatinus Oan-Mir-191_5p (mature (guide))
    19. Oryctolagus cuniculus ocu-miR-191-5p
    20. Otolemur garnettii oga-miR-191
    21. Pan paniscus ppa-miR-191
    22. Pan troglodytes (chimpanzee) ptr-miR-191
    23. Papio hamadryas pha-miR-191
    24. Pongo pygmaeus ppy-miR-191
    25. Python bivittatus pbv-miR-191-5p
    26. Rattus norvegicus rno-miR-191a-5p
    27. Saimiri boliviensis boliviensis sbo-miR-191
    28. Sus scrofa ssc-miR-191
    29. Xenopus tropicalis Xtr-Mir-191_5p (mature (guide))