Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR390-5p URS00005C2DB4_39947

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Oryza sativa Japonica Group. Annotated by 1 database (ENA). Described in 1 paper. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR390-5p sequence is a product of miR390-5p, miR390, osa-miR390, osa-miR390-5p genes. Found in the japanese rice reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AAGCUCAGGAGGGAUAGCGCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 37 other species

    1. Aegilops tauschii ata-miR390-5p
    2. Amborella trichopoda atr-miR390.2
    3. Ananas comosus miR390
    4. Arabidopsis lyrata aly-miR390b-5p
    5. Arabidopsis thaliana (thale cress) ath-miR390a-5p
    6. Asparagus officinalis aof-miR390
    7. Brachypodium distachyon (stiff brome) bdi-miR390a-5p
    8. Brassica napus (rape) bna-miR390b
    9. Brassica rapa (field mustard) bra-miR390-5p
    10. Camelina sativa cas-miR390a-5p
    11. Carica papaya (papaya) cpa-miR390b
    12. Citrus sinensis csi-miR390a-5p
    13. Corchorus capsularis sRNA CCACVL1_11672
    14. Corchorus olitorius aly-miR390a-
    15. Cucumis melo cme-miR390b
    16. Fragaria vesca subsp. vesca fve-miR390b
    17. Glycine max (soybean) gma-miR390a-5p
    18. Gossypium hirsutum (cotton) ghr-miR390b
    19. Helianthus annuus sRNA HannXRQ_Chr08g0228705
    20. Helianthus exilis hex-miR390b
    21. Linum usitatissimum (flax) lus-miR390a
    22. Lotus japonicus lja-miR390a-5p
    23. Malus domestica mdm-miR390f
    24. Manihot esculenta mes-miR390b
    25. Medicago truncatula mtr-miR390
    26. Nicotiana tabacum nta-miR390c
    27. Oryza sativa osa-miR390-5p
    28. Physcomitrium patens ppt-miR390a
    29. Picea abies (Norway spruce) pab-miR390b
    30. Populus tomentosa Pto-miR390b
    31. Populus trichocarpa ptc-miR390b
    32. Prunus persica (peach) ppe-miR390
    33. Ricinus communis (castor bean) rco-miR390a
    34. Solanum lycopersicum sly-miR390b-5p
    35. Sorghum bicolor (sorghum) sbi-miR390
    36. Theobroma cacao tcc-miR390a
    37. Vitis vinifera (wine grape) vvi-miR390
    38. Zea mays zma-miR390a-5p