Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3149 URS00005C1F22_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3149: Hsa-mir-3149 is a microRNA that has been implicated in various biological processes and diseases. It has been reported to play a role in tumorigenesis, DNA repair, and immunity [PMC7851581]. In osteosarcoma, the downregulation of hsa-mir-3149 has been shown to promote cell proliferation and metastasis [PMC7851581]. In addition, hsa-mir-3149 has been found to inhibit the expression of ovarian tumor protease deubiquitinase 5 (OTUD5), suggesting its involvement in DNA repair and immunity [PMC7851581]. Hsa-mir-3149 has also been associated with glaucoma, with lower expression levels observed in glaucoma patients compared to controls [PMC8237107]. Furthermore, hsa-mir-3149 is among the miRNAs that are differentially expressed in gastric carcinoma compared to normal gastric cells [PMC6584754]. It is worth noting that hsa-mir-3149 is also associated with poor overall survival in cervical squamous cell carcinoma (CESC) patients [PMC7333649]. These findings highlight the potential role of hsa-mir-3149 as a biomarker and therapeutic target for various diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGUAUGGAUAUGUGUGUGUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications