Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS00005B750F_559292

Automated summary: This snoRNA sequence is 101 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 3 databases (ENA, SGD, RefSeq). Described in 26 papers. Matches 1 Rfam family (snosnR64, RF00509). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR64 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUGUAUGAUGAGGAACCAGAUAGGGACAACAGAUUCUCAAGUGACGAGGAACAUCUUUUAAAGCCCAGUUUUUAGUAGAGCUUAGGGCGCCUUUACUGACU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 48 other species

    1. Saccharomyces cerevisiae small nucleolar RNA snR64
    2. Saccharomyces cerevisiae Kyokai no. 7 K7_snR64
    3. Saccharomyces cerevisiae PE-2 SNR64
    4. Saccharomyces cerevisiae YJM1133 SNR64
    5. Saccharomyces cerevisiae YJM1248 SNR64
    6. Saccharomyces cerevisiae YJM1273 SNR64
    7. Saccharomyces cerevisiae YJM1304 SNR64
    8. Saccharomyces cerevisiae YJM1307 SNR64
    9. Saccharomyces cerevisiae YJM1326 SNR64
    10. Saccharomyces cerevisiae YJM1332 SNR64
    11. Saccharomyces cerevisiae YJM1342 SNR64
    12. Saccharomyces cerevisiae YJM1385 SNR64
    13. Saccharomyces cerevisiae YJM1386 SNR64
    14. Saccharomyces cerevisiae YJM1388 SNR64
    15. Saccharomyces cerevisiae YJM1389 SNR64
    16. Saccharomyces cerevisiae YJM1400 SNR64
    17. Saccharomyces cerevisiae YJM1401 SNR64
    18. Saccharomyces cerevisiae YJM1402 SNR64
    19. Saccharomyces cerevisiae YJM1418 SNR64
    20. Saccharomyces cerevisiae YJM1419 SNR64
    21. Saccharomyces cerevisiae YJM1434 SNR64
    22. Saccharomyces cerevisiae YJM1439 SNR64
    23. Saccharomyces cerevisiae YJM1443 SNR64
    24. Saccharomyces cerevisiae YJM1444 SNR64
    25. Saccharomyces cerevisiae YJM1447 SNR64
    26. Saccharomyces cerevisiae YJM1450 SNR64
    27. Saccharomyces cerevisiae YJM1460 SNR64
    28. Saccharomyces cerevisiae YJM1478 SNR64
    29. Saccharomyces cerevisiae YJM1479 SNR64
    30. Saccharomyces cerevisiae YJM1527 SNR64
    31. Saccharomyces cerevisiae YJM1549 SNR64
    32. Saccharomyces cerevisiae YJM1573 SNR64
    33. Saccharomyces cerevisiae YJM1592 SNR64
    34. Saccharomyces cerevisiae YJM193 SNR64
    35. Saccharomyces cerevisiae YJM195 SNR64
    36. Saccharomyces cerevisiae YJM271 SNR64
    37. Saccharomyces cerevisiae YJM326 SNR64
    38. Saccharomyces cerevisiae YJM428 SNR64
    39. Saccharomyces cerevisiae YJM450 SNR64
    40. Saccharomyces cerevisiae YJM456 SNR64
    41. Saccharomyces cerevisiae YJM541 SNR64
    42. Saccharomyces cerevisiae YJM554 SNR64
    43. Saccharomyces cerevisiae YJM555 SNR64
    44. Saccharomyces cerevisiae YJM627 SNR64
    45. Saccharomyces cerevisiae YJM682 SNR64
    46. Saccharomyces cerevisiae YJM683 SNR64
    47. Saccharomyces cerevisiae YJM689 SNR64
    48. Saccharomyces cerevisiae YJM693 SNR64