Equus caballus (horse) eca-miR-195 URS00005B3525_9796

• 21 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 14 other species
• 124 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UAGCAGCACAGAAAUAUUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

1. Capra hircus (goat) miR-195
2. Gorilla gorilla gorilla ggo-miR-195 (MIR195)
3. Gorilla gorilla (western gorilla) ggo-miR-195
4. Homo sapiens (human) hsa-miR-195-5p
5. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) miR-195
6. Macaca mulatta (Rhesus monkey) mml-miR-195-5p
7. Mus musculus (house mouse) mmu-miR-195a-5p
8. Ovis aries (sheep) miscellaneous RNA
9. Pan paniscus ppa-miR-195
10. Pan troglodytes (chimpanzee) ptr-miR-195
11. Pongo pygmaeus ppy-miR-195
12. Rattus norvegicus rno-miR-195-5p
13. Sus scrofa (pig) ssc-miR-195
14. Tursiops truncatus (common bottlenose dolphin) miR-195a

Publications Download

• FASTA
• JSON