v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-195-5p URS00005B3525_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (MalaCards, miRBase, GeneCards, IntAct, TarBase, ENA, RefSeq, LncBase). Homo sapiens (human) hsa-miR-195-5p sequence is a product of hsa-miR-195, MIR195, miR-195-5p, hsa-miR-195-5p, miR-195 genes. Found in the Homo sapiens reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3GAMMA, 14-3-3γ, 15E1.2, 16E1BP, 17-BETA-HSD11, 17-BETA-HSDXI, 182-FIP, 2C4D, 2OST, 2P1.

Interactions 23

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-195-5p interacts with:

Interaction id Participant Synonyms
EBI-11463270 ddbj/embl/genbank:AF010193.1 AF010193.1 EBI-11463474 smad7_human_mrna
EBI-25507718 intact:EBI-25470264 EBI-25470264 ENST00000403681 mrna_hmga2
EBI-25507245 intact:EBI-25470264 EBI-25470264 ENST00000403681 mrna_hmga2
EBI-32734113 intact:EBI-32734102 EBI-32734102 ENST00000375256 mrna_znf367
URS00005B3525_9606-0 O15111 O15111
URS00005B3525_9606-1 P05067 P05067
URS00005B3525_9606-2 P06213 P06213
URS00005B3525_9606-12 P06213 P06213
URS00005B3525_9606-13 P09038 P09038
URS00005B3525_9606-3 P09038 P09038
URS00005B3525_9606-14 P10909 P10909
URS00005B3525_9606-4 P10909 P10909
URS00005B3525_9606-6 P15692 P15692
URS00005B3525_9606-15 P15692 P15692
URS00005B3525_9606-5 P15692 P15692
URS00005B3525_9606-16 P49238 P49238
URS00005B3525_9606-7 P49238 P49238
URS00005B3525_9606-8 P56817 P56817
URS00005B3525_9606-17 P78423 P78423
URS00005B3525_9606-9 P78423 P78423
URS00005B3525_9606-18 P78423 P78423
URS00005B3525_9606-10 P78423 P78423
URS00005B3525_9606-11 Q8N5C8 Q8N5C8

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UAGCAGCACAGAAAUAUUGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Capra hircus miR-195
    2. Equus caballus eca-miR-195
    3. Gorilla gorilla (western gorilla) ggo-miR-195
    4. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) miR-195
    5. Macaca mulatta mml-miR-195-5p
    6. Mus musculus (house mouse) mmu-miR-195a-5p
    7. Ovis aries miscellaneous RNA
    8. Pan paniscus ppa-miR-195
    9. Pan troglodytes ptr-miR-195
    10. Pongo pygmaeus (Bornean orangutan) ppy-miR-195
    11. Rattus norvegicus rno-miR-195-5p
    12. Sus scrofa (pig) ssc-miR-195
    13. Tursiops truncatus miR-195a
     Publications