Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ictidomys tridecemlineatus (thirteen-lined ground squirrel) miR-195 URS00005B3525_43179

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Ictidomys tridecemlineatus. Annotated by 1 database (ENA). Ictidomys tridecemlineatus (thirteen-lined ground squirrel) miR-195 sequence is a product of miR-195, 195 genes. Found in the Ictidomys tridecemlineatus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAGCAGCACAGAAAUAUUGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Capra hircus miR-195
    2. Equus caballus eca-miR-195
    3. Gorilla gorilla (western gorilla) ggo-miR-195
    4. Homo sapiens hsa-miR-195-5p
    5. Macaca mulatta mml-miR-195-5p
    6. Mus musculus (house mouse) mmu-miR-195a-5p
    7. Ovis aries miscellaneous RNA
    8. Pan paniscus ppa-miR-195
    9. Pan troglodytes ptr-miR-195
    10. Pongo pygmaeus (Bornean orangutan) ppy-miR-195
    11. Rattus norvegicus rno-miR-195-5p
    12. Sus scrofa (pig) ssc-miR-195
    13. Tursiops truncatus miR-195a