v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-195-5p URS00005B3525_10116

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Rattus norvegicus. Annotated by 3 databases (IntAct, miRBase, RefSeq). Rattus norvegicus (Norway rat) rno-miR-195-5p sequence is a product of rno-miR-195, rno-miR-195-5p, miR-195-5p, Mir195, miR-195 genes. Found in the Rattus norvegicus reference genome.

Interactions 4

According to PSICQUIC and IntAct, Rattus norvegicus (Norway rat) rno-miR-195-5p interacts with:

Interaction id Participant Synonyms
EBI-26440943 intact:EBI-26440946 EBI-26440946 ENSRNOT00000021840 mrna_igf2r_rat
EBI-26440961 intact:EBI-26440967 EBI-26440967 ENSRNOT00000088370 mrna_stim1
URS00005B3525_10116-0 F1LNV0 F1LNV0
URS00005B3525_10116-1 G3V8V0 G3V8V0

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UAGCAGCACAGAAAUAUUGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Capra hircus miR-195
    2. Equus caballus eca-miR-195
    3. Gorilla gorilla (western gorilla) ggo-miR-195
    4. Homo sapiens hsa-miR-195-5p
    5. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) miR-195
    6. Macaca mulatta mml-miR-195-5p
    7. Mus musculus (house mouse) mmu-miR-195a-5p
    8. Ovis aries miscellaneous RNA
    9. Pan paniscus ppa-miR-195
    10. Pan troglodytes ptr-miR-195
    11. Pongo pygmaeus (Bornean orangutan) ppy-miR-195
    12. Sus scrofa (pig) ssc-miR-195
    13. Tursiops truncatus miR-195a
     Publications