Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-195a-5p URS00005B3525_10090

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Mus musculus. Annotated by 7 databases (TarBase, RefSeq, PirBase, LncBase, miRBase, ENA, PSICQUIC). Described in 41 papers. Mus musculus (house mouse) mmu-miR-195a-5p sequence is a product of 195, miR-195a, mmu-miR-195a, mmu-miR-195a-5p, Mir195a, miR-195a-5p, miR-195 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610007L03Rik, 0610009B22Rik, 0610041L09Rik, 0710008J23Rik, 1110001M01Rik, 1110001M20Rik, 1110003E12Rik, 1110011O05Rik, 1110014L17Rik, 1110014O20Rik.

Interactions 7

According to PSICQUIC, Mus musculus (house mouse) mmu-miR-195a-5p interacts with:

Interaction id Participant Synonyms
URS00005B3525_10090-0 O35280 O35280
URS00005B3525_10090-4 O35280 O35280
URS00005B3525_10090-1 O70372 O70372
URS00005B3525_10090-5 O70372 O70372
URS00005B3525_10090-6 P54320 P54320
URS00005B3525_10090-2 P54320 P54320
URS00005B3525_10090-3 Q923E4 Q923E4

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAGCAGCACAGAAAUAUUGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 22 other species

    1. Capra hircus miR-195
    2. Equus caballus eca-miR-195
    3. Gorilla gorilla (western gorilla) ggo-miR-195
    4. Homo sapiens (human) hsa-miR-195-5p
    5. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) miR-195
    6. Macaca mulatta mml-miR-195-5p
    7. Ovis aries (sheep) miscellaneous RNA
    8. Pan paniscus ppa-miR-195
    9. Pan troglodytes (chimpanzee) ptr-miR-195
    10. Pongo pygmaeus ppy-miR-195
    11. Rattus norvegicus rno-miR-195-5p
    12. Sus scrofa ssc-miR-195
    13. Tursiops truncatus miR-195a