Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS00005B0F32_559292

  • 82 nucleotides
  • 5 databases (ENA, IntAct, RefSeq, Rfam, SGD)
  • Found in 109 species

Automated summary: This snoRNA sequence is 82 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (RefSeq, IntAct, ENA, Rfam, SGD). Described in 27 papers. Matches 1 Rfam family (snR67, RF01177). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR67 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 1

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

Interaction id Participant Synonyms
EBI-11793634 URS000061F377_559292 EBI-10903441 URS000061F377_559292 rrna 25s yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAACAUGAUGACUAAGUUGUCGCCCCAAGCGGAUCUUUGAAAUGACUGAUUUUACAAACAACAAACACUGAAAAUUCUGAAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 108 other species

    1. Marmota marmota marmota (Alpine marmot) snoRNA (ENSMMMG00000010158.1)
    2. Saccharomyces arboricola H-6 Small nucleolar RNA snR67
    3. Saccharomyces cerevisiae AWRI796 Small nucleolar RNA snR67
    4. Saccharomyces cerevisiae small nucleolar RNA snR67
    5. Saccharomyces cerevisiae EC1118 SNR67
    6. Saccharomyces cerevisiae FostersB Small nucleolar RNA snR67
    7. Saccharomyces cerevisiae FostersO Small nucleolar RNA snR67
    8. Saccharomyces cerevisiae Kyokai no. 7 K7_snR67
    9. Saccharomyces cerevisiae Lalvin QA23 Small nucleolar RNA snR67
    10. Saccharomyces cerevisiae P283 SNR67
    11. Saccharomyces cerevisiae P301 SNR67
    12. Saccharomyces cerevisiae PE-2 SNR67
    13. Saccharomyces cerevisiae R008 SNR67
    14. Saccharomyces cerevisiae VL3 Small nucleolar RNA snR67
    15. Saccharomyces cerevisiae YJM1078 SNR67
    16. Saccharomyces cerevisiae YJM1083 SNR67
    17. Saccharomyces cerevisiae YJM1129 SNR67
    18. Saccharomyces cerevisiae YJM1133 SNR67
    19. Saccharomyces cerevisiae YJM1190 SNR67
    20. Saccharomyces cerevisiae YJM1199 SNR67
    21. Saccharomyces cerevisiae YJM1202 SNR67
    22. Saccharomyces cerevisiae YJM1208 SNR67
    23. Saccharomyces cerevisiae YJM1242 SNR67
    24. Saccharomyces cerevisiae YJM1244 SNR67
    25. Saccharomyces cerevisiae YJM1248 SNR67
    26. Saccharomyces cerevisiae YJM1250 SNR67
    27. Saccharomyces cerevisiae YJM1252 SNR67
    28. Saccharomyces cerevisiae YJM1273 SNR67
    29. Saccharomyces cerevisiae YJM1304 SNR67
    30. Saccharomyces cerevisiae YJM1307 SNR67
    31. Saccharomyces cerevisiae YJM1311 SNR67
    32. Saccharomyces cerevisiae YJM1326 SNR67
    33. Saccharomyces cerevisiae YJM1332 SNR67
    34. Saccharomyces cerevisiae YJM1336 SNR67
    35. Saccharomyces cerevisiae YJM1338 SNR67
    36. Saccharomyces cerevisiae YJM1341 SNR67
    37. Saccharomyces cerevisiae YJM1342 SNR67
    38. Saccharomyces cerevisiae YJM1355 SNR67
    39. Saccharomyces cerevisiae YJM1356 SNR67
    40. Saccharomyces cerevisiae YJM1381 SNR67
    41. Saccharomyces cerevisiae YJM1383 SNR67
    42. Saccharomyces cerevisiae YJM1385 SNR67
    43. Saccharomyces cerevisiae YJM1386 SNR67
    44. Saccharomyces cerevisiae YJM1387 SNR67
    45. Saccharomyces cerevisiae YJM1388 SNR67
    46. Saccharomyces cerevisiae YJM1389 SNR67
    47. Saccharomyces cerevisiae YJM1399 SNR67
    48. Saccharomyces cerevisiae YJM1400 SNR67
    49. Saccharomyces cerevisiae YJM1401 SNR67
    50. Saccharomyces cerevisiae YJM1402 SNR67
    51. Saccharomyces cerevisiae YJM1415 SNR67
    52. Saccharomyces cerevisiae YJM1417 SNR67
    53. Saccharomyces cerevisiae YJM1418 SNR67
    54. Saccharomyces cerevisiae YJM1419 SNR67
    55. Saccharomyces cerevisiae YJM1433 SNR67
    56. Saccharomyces cerevisiae YJM1434 SNR67
    57. Saccharomyces cerevisiae YJM1439 SNR67
    58. Saccharomyces cerevisiae YJM1443 SNR67
    59. Saccharomyces cerevisiae YJM1444 SNR67
    60. Saccharomyces cerevisiae YJM1447 SNR67
    61. Saccharomyces cerevisiae YJM1450 SNR67
    62. Saccharomyces cerevisiae YJM1460 SNR67
    63. Saccharomyces cerevisiae YJM1463 SNR67
    64. Saccharomyces cerevisiae YJM1477 SNR67
    65. Saccharomyces cerevisiae YJM1478 SNR67
    66. Saccharomyces cerevisiae YJM1479 SNR67
    67. Saccharomyces cerevisiae YJM1526 SNR67
    68. Saccharomyces cerevisiae YJM1527 SNR67
    69. Saccharomyces cerevisiae YJM1549 SNR67
    70. Saccharomyces cerevisiae YJM1573 SNR67
    71. Saccharomyces cerevisiae YJM1574 SNR67
    72. Saccharomyces cerevisiae YJM1592 SNR67
    73. Saccharomyces cerevisiae YJM1615 SNR67
    74. Saccharomyces cerevisiae YJM189 SNR67
    75. Saccharomyces cerevisiae YJM193 SNR67
    76. Saccharomyces cerevisiae YJM195 SNR67
    77. Saccharomyces cerevisiae YJM244 SNR67
    78. Saccharomyces cerevisiae YJM248 SNR67
    79. Saccharomyces cerevisiae YJM270 SNR67
    80. Saccharomyces cerevisiae YJM271 SNR67
    81. Saccharomyces cerevisiae YJM320 SNR67
    82. Saccharomyces cerevisiae YJM326 SNR67
    83. Saccharomyces cerevisiae YJM428 SNR67
    84. Saccharomyces cerevisiae YJM450 SNR67
    85. Saccharomyces cerevisiae YJM451 SNR67
    86. Saccharomyces cerevisiae YJM453 SNR67
    87. Saccharomyces cerevisiae YJM456 SNR67
    88. Saccharomyces cerevisiae YJM470 SNR67
    89. Saccharomyces cerevisiae YJM541 SNR67
    90. Saccharomyces cerevisiae YJM554 SNR67
    91. Saccharomyces cerevisiae YJM555 SNR67
    92. Saccharomyces cerevisiae YJM627 SNR67
    93. Saccharomyces cerevisiae YJM681 SNR67
    94. Saccharomyces cerevisiae YJM682 SNR67
    95. Saccharomyces cerevisiae YJM683 SNR67
    96. Saccharomyces cerevisiae YJM689 SNR67
    97. Saccharomyces cerevisiae YJM693 SNR67
    98. Saccharomyces cerevisiae YJM969 SNR67
    99. Saccharomyces cerevisiae YJM972 SNR67
    100. Saccharomyces cerevisiae YJM975 SNR67
    101. Saccharomyces cerevisiae YJM978 SNR67
    102. Saccharomyces cerevisiae YJM981 SNR67
    103. Saccharomyces cerevisiae YJM984 SNR67
    104. Saccharomyces cerevisiae YJM987 SNR67
    105. Saccharomyces cerevisiae YJM990 SNR67
    106. Saccharomyces cerevisiae YJM993 SNR67
    107. Saccharomyces cerevisiae YJM996 SNR67