Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, C/D box 94 (SNORD94) URS00005ACA64_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD94: SNORD94 is a C/D box scaRNA that targets a cytosine at position 62 (C62) on spliceosomal RNA (snRNA) U6 for 2’-O-methylation [PMC6894857]. In a study comparing gene expression in Tetralogy of Fallot (TOF) patients, SNORD94 was found to be one of the top downregulated genes [PMC9622801]. SNORD94 is involved in U6 snRNA modifications, which are important for spliceosomal function [PMC6023535]. In cell culture experiments, the change in SNORD94 expression was the only difference observed in knockdown and overexpression experiments [PMC6894857]. The expression level of SNORD94 was confirmed using qRT-PCR [PMC6894857]. In B cells, SNORD94 expression is reduced compared to other B cell types, suggesting its role in B cell maturation and function [PMC10050728]. The interaction between regRNP17 and SNORD94 disrupts the interaction between SNORD94 and U6 snRNA [PMC6124571]. Methylation at C62 on snRNA U6 is reduced in right ventricle tissue of children with TOF compared to control, suggesting a link between levels of SNORD94 and levels of C62 methylation [PMC6894857]. The study hypothesizes that proper expression levels of SNORD94 and other scaRNAs are important for spliceosomal function and may play a role in regulating heart development [PMC6894857].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGGCUGUGAUGAUUGGCGCAGGGGUACGGACCUCAGCUGAGUCAUGGGAGCUGAAUGUAUGUGUUUCUCCUUUGUCCUGCAUGUGGCAGGCUGAUGGGGAGCACUUACAUGAGACUGUUGCCUCAAUCUGAGCCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications