Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) testis expressed transcript, Y-linked 16 (TTTY16) URS00005ABE66_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

TTTY16: TTTY16 is a long non-coding RNA (lncRNA) that has been studied in various contexts. In the ENVIRONAGE cohort, TTTY16 was found to be negatively associated with ten transcripts, including XLOC_008311, LOC102724800, XLOC_014512, AADACP1, SSTR5-AS1, CHMP7, and FLJ32756 [PMC9831885]. TTTY16 was also identified as one of the genes in a four-gene clustering model that plays a role in positive regulation of ERK1 and ERK2 cascade, angiogenesis, platelet degranulation, cell-matrix adhesion, extracellular matrix organization and macrophage activation [PMC7926392]. In the context of lung squamous cell carcinoma (LUSC), TTTY16 was down-regulated and correlated with a good prognosis [PMC8799054]. Additionally, TTTY16 was found to be one of the lncRNA signatures in the ceRNA network that were linked to overall survival in LUSC patients [PMC8799054]. In another study on non-small cell lung cancer (NSCLC) patients' overall survival prediction model identified TTTY16 as one of the lncRNAs connected with overall survival [PMC8773641]. These findings highlight the potential role of TTTY16 in various biological processes and its association with prognosis in different cancer types.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGUGUGGAUUAUGCCCUGGCCAUGUCCUCAUGUUUCCCAACGGCUGGGAGUCAGAAAUUGAGUGACCUGGGAGCACCUUUGUUGUGCCAUCUAUAGCAAAAAGACACUUGGGUGCAAGUGGGAAUCUUGAGUCACUUUGAGGAGCAUUGCACAAAGCCCUAUGUCUUCAGCCAAGUGCACCCUUUCCUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications