Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-2278 URS000059EB31_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-2278: Hsa-mir-2278 is a microRNA that has been studied in various contexts. In a study examining miRNAs in SPOCK2, it was found that increased expression of hsa-mir-2278 was associated with unfavorable overall survival (OS) [PMC6932902]. Another study identified hsa-mir-2278 as one of the miRNAs with co-target genes that are TETs [PMC8798779]. Additionally, hsa-mir-2278 was among the 16 markers identified in a study investigating the ceRNET network [PMC4076980]. In this network, hsa-mir-2278, along with hsa-miR-3176 and hsa-miR-3654, were found to be the most important cores [PMC8799182]. Furthermore, there was a statistically significant correlation between hsa-mir-2278 and patient OS [PMC8799182]. Hsa-mir-2278 has also been associated with TFF1 and poor prognostic outcomes in triple-negative breast cancer (TNBC) [PMC9493148]. Additionally, it has been shown to be differentially expressed between tumor and normal breast tissues [PMC9493148]. In head and neck squamous cell carcinoma (HPSCC), hsa-mir-2278 was one of the top 3 downregulated miRNAs [PMC6072292]. Furthermore, it has been associated with survival in both rectal and colon cancer [PMC6072292]. References: [PMC6932902] [PMC8798779] [PMC4076980] [PMC8799182] [PMC9493148] [PMC6072292]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGAGCAGUGUGUGUUGCCUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications